Incidental Mutation 'R5975:Rnf111'
ID 471695
Institutional Source Beutler Lab
Gene Symbol Rnf111
Ensembl Gene ENSMUSG00000032217
Gene Name ring finger 111
Synonyms Arkadia
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5975 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 70425424-70503725 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 70429580 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 942 (S942P)
Ref Sequence ENSEMBL: ENSMUSP00000109225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034739] [ENSMUST00000113595] [ENSMUST00000213647] [ENSMUST00000215848]
AlphaFold Q99ML9
Predicted Effect probably damaging
Transcript: ENSMUST00000034739
AA Change: S942P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034739
Gene: ENSMUSG00000032217
AA Change: S942P

DomainStartEndE-ValueType
Pfam:RNF111_N 18 290 2.5e-112 PFAM
low complexity region 340 355 N/A INTRINSIC
low complexity region 503 518 N/A INTRINSIC
low complexity region 623 632 N/A INTRINSIC
low complexity region 692 707 N/A INTRINSIC
low complexity region 744 758 N/A INTRINSIC
low complexity region 759 776 N/A INTRINSIC
low complexity region 820 837 N/A INTRINSIC
low complexity region 924 935 N/A INTRINSIC
RING 937 977 3e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113595
AA Change: S942P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109225
Gene: ENSMUSG00000032217
AA Change: S942P

DomainStartEndE-ValueType
Pfam:RNF111_N 18 290 1.8e-97 PFAM
low complexity region 340 355 N/A INTRINSIC
low complexity region 503 518 N/A INTRINSIC
low complexity region 623 632 N/A INTRINSIC
low complexity region 692 707 N/A INTRINSIC
low complexity region 744 758 N/A INTRINSIC
low complexity region 759 776 N/A INTRINSIC
low complexity region 820 837 N/A INTRINSIC
low complexity region 924 935 N/A INTRINSIC
RING 937 977 3e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213208
Predicted Effect probably damaging
Transcript: ENSMUST00000213647
AA Change: S933P

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213996
Predicted Effect probably damaging
Transcript: ENSMUST00000215848
AA Change: S934P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.5163 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 98% (80/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear RING-domain containing E3 ubiquitin ligase. This protein interacts with the transforming growth factor (TGF) -beta/NODAL signaling pathway by promoting the ubiquitination and proteosomal degradation of negative regulators, like SMAD proteins, and thereby enhances TGF-beta target-gene transcription. As a modulator of the nodal signaling cascade, this gene plays a critical role in the induction of mesoderm during embryonic development. Alternative splicing of this gene results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele fail to develop anterior structures and midline with failure to develop anterior endoderm, node and mesendoderm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 36,969,221 T2233I possibly damaging Het
9430038I01Rik T C 7: 137,387,292 probably benign Het
Abhd14a A T 9: 106,443,951 probably null Het
Actn2 T C 13: 12,340,497 N2D probably benign Het
Adcy9 T C 16: 4,311,567 E722G probably damaging Het
Alox12 C A 11: 70,242,783 V572L possibly damaging Het
Ankrd11 T C 8: 122,889,749 I2434V possibly damaging Het
Anks1 T A 17: 27,991,447 probably null Het
Bpifa3 T A 2: 154,136,321 S148T probably damaging Het
Bptf C T 11: 107,035,864 probably benign Het
Cabin1 A T 10: 75,657,839 L1655H probably damaging Het
Ccdc13 G T 9: 121,827,235 Q171K probably benign Het
Ccdc33 T A 9: 58,117,478 Q155L possibly damaging Het
Cckbr G A 7: 105,470,619 G280E probably benign Het
Cdk11b G A 4: 155,648,240 probably benign Het
Celsr1 G T 15: 85,919,038 probably null Het
Cenpj A T 14: 56,564,066 I150N possibly damaging Het
Cep135 C A 5: 76,640,890 A1110E possibly damaging Het
Chit1 C A 1: 134,146,626 H224N probably damaging Het
Cul5 T C 9: 53,622,793 R680G probably damaging Het
Dhx58 C A 11: 100,702,209 R224L probably damaging Het
Dlx1 C A 2: 71,531,009 N122K probably damaging Het
Dnah5 A C 15: 28,234,282 D279A probably damaging Het
Enpp3 A G 10: 24,774,842 W799R probably benign Het
Ercc5 A G 1: 44,173,406 T675A probably benign Het
Farsa T A 8: 84,864,432 probably null Het
Fbxw15 A T 9: 109,555,252 V397D probably damaging Het
Fcrl5 G A 3: 87,442,103 V62I probably benign Het
Gart A G 16: 91,624,336 S815P probably damaging Het
Glrx5 A G 12: 105,040,323 N111S possibly damaging Het
Gm10845 A G 14: 79,863,174 noncoding transcript Het
Gm11639 A G 11: 104,687,549 probably benign Het
Gm8882 A G 6: 132,362,073 S61P unknown Het
Gm9925 T A 18: 74,065,516 probably benign Het
Gsdme T C 6: 50,227,359 N206S probably benign Het
Helz2 T C 2: 181,231,050 S2459G probably benign Het
Hnrnpul1 A G 7: 25,754,359 S93P possibly damaging Het
Ints2 A T 11: 86,226,748 I716N possibly damaging Het
Lmnb2 G A 10: 80,905,128 Q248* probably null Het
Map3k7cl A G 16: 87,570,321 I32V probably benign Het
Mfsd4b4 A T 10: 39,892,470 I255N probably benign Het
Myh6 A G 14: 54,950,508 I1163T probably benign Het
Nphs1 A T 7: 30,466,115 T636S possibly damaging Het
Ntsr1 T A 2: 180,500,788 L124Q probably damaging Het
Obscn C T 11: 59,122,619 probably null Het
P4ha2 G A 11: 54,126,412 probably null Het
Pcdha9 T A 18: 36,999,111 V411D probably benign Het
Pkhd1l1 A T 15: 44,525,988 I1380F probably damaging Het
Plekha1 T C 7: 130,892,253 V106A probably benign Het
Plekhm1 A T 11: 103,376,691 V818E possibly damaging Het
Pprc1 T G 19: 46,065,370 probably benign Het
Prmt9 T C 8: 77,561,018 probably benign Het
Rab26 T C 17: 24,530,399 N193D possibly damaging Het
Scgb2b18 T C 7: 33,173,225 T52A probably damaging Het
Syt3 C T 7: 44,392,763 Q349* probably null Het
Tas2r107 T C 6: 131,659,780 N102S probably benign Het
Tas2r126 T A 6: 42,435,000 Y156N possibly damaging Het
Tcaf2 A T 6: 42,642,778 I105N probably benign Het
Tet1 A C 10: 62,879,773 M81R probably benign Het
Togaram2 T C 17: 71,729,205 Y897H probably damaging Het
Trerf1 A T 17: 47,314,271 noncoding transcript Het
Ttn G A 2: 76,761,235 T12703I probably damaging Het
Unc79 A G 12: 103,125,626 K1735E possibly damaging Het
Usp54 G A 14: 20,583,351 T372I possibly damaging Het
Wdr24 T C 17: 25,827,128 S476P probably benign Het
Wdr78 G A 4: 103,049,589 P676S probably benign Het
Zbtb1 T C 12: 76,386,275 I345T possibly damaging Het
Zcrb1 T A 15: 93,395,615 I29L probably benign Het
Zfp341 T A 2: 154,630,441 C315S probably damaging Het
Zfp623 C A 15: 75,948,163 R323S probably benign Het
Zfp831 T A 2: 174,644,092 Y187N possibly damaging Het
Other mutations in Rnf111
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02473:Rnf111 APN 9 70440858 missense probably damaging 1.00
IGL02567:Rnf111 APN 9 70459005 missense probably damaging 1.00
R0052:Rnf111 UTSW 9 70476389 missense probably benign 0.00
R0245:Rnf111 UTSW 9 70453831 splice site probably benign
R0760:Rnf111 UTSW 9 70429678 missense probably damaging 1.00
R1327:Rnf111 UTSW 9 70453816 missense possibly damaging 0.60
R1778:Rnf111 UTSW 9 70476112 missense probably benign 0.00
R1884:Rnf111 UTSW 9 70476238 missense probably damaging 0.99
R1892:Rnf111 UTSW 9 70476374 missense probably damaging 1.00
R2261:Rnf111 UTSW 9 70476391 missense probably benign
R2762:Rnf111 UTSW 9 70476045 missense possibly damaging 0.82
R3980:Rnf111 UTSW 9 70442325 missense probably damaging 1.00
R4577:Rnf111 UTSW 9 70429584 nonsense probably null
R4631:Rnf111 UTSW 9 70450396 missense probably benign 0.07
R4804:Rnf111 UTSW 9 70430957 missense possibly damaging 0.70
R5153:Rnf111 UTSW 9 70476140 missense probably benign 0.35
R5500:Rnf111 UTSW 9 70476043 missense possibly damaging 0.94
R5546:Rnf111 UTSW 9 70459096 missense probably benign 0.05
R6395:Rnf111 UTSW 9 70476410 missense possibly damaging 0.95
R6482:Rnf111 UTSW 9 70429607 missense probably damaging 1.00
R7056:Rnf111 UTSW 9 70453675 missense possibly damaging 0.60
R7239:Rnf111 UTSW 9 70469373 missense probably damaging 1.00
R7444:Rnf111 UTSW 9 70440843 missense probably damaging 1.00
R7618:Rnf111 UTSW 9 70503332 start gained probably benign
R8068:Rnf111 UTSW 9 70457941 missense probably benign 0.00
R8323:Rnf111 UTSW 9 70475922 missense probably benign 0.03
R8444:Rnf111 UTSW 9 70457941 missense probably benign 0.00
R8997:Rnf111 UTSW 9 70476263 missense probably damaging 0.98
R9108:Rnf111 UTSW 9 70429564 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACCAGTTGATCCATTTGTGAATC -3'
(R):5'- ACTGTTGACTTCCAGGAGTCAG -3'

Sequencing Primer
(F):5'- GAATCAATCACCTATCTGTGGTGCTG -3'
(R):5'- CTTCCAGGAGTCAGTAATTAATTGG -3'
Posted On 2017-03-31