Mutagenetix > Incidental Mutation

Incidental Mutation 'R5975:Enpp3'

471698

Institutional Source

Beutler Lab

Gene Symbol

Enpp3

Ensembl Gene

ENSMUSG00000019989

Gene Name

ectonucleotide pyrophosphatase/phosphodiesterase 3

Synonyms

CD203c

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.194) question?

Stock #

R5975 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

24772406-24842823 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 24774842 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 799 (W799R)

Ref Sequence

ENSEMBL: ENSMUSP00000020169 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020169]

AlphaFold

Q6DYE8

Predicted Effect

probably benign
Transcript: ENSMUST00000020169
AA Change: W799R

PolyPhen 2 Score 0.370 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000020169
Gene: ENSMUSG00000019989
AA Change: W799R

Domain	Start	End	E-Value	Type
transmembrane domain	23	45	N/A	INTRINSIC
SO	50	93	1.99e-13	SMART
SO	94	137	7.66e-15	SMART
Pfam:Phosphodiest	161	485	1.7e-87	PFAM
Blast:Endonuclease_NS	543	599	9e-15	BLAST
Endonuclease_NS	626	847	5.41e-16	SMART
NUC	627	856	1.54e-92	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000218343

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219861

Meta Mutation Damage Score

0.1374

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.8%
20x: 93.3%

Validation Efficiency

98% (80/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a series of ectoenzymes that are involved in hydrolysis of extracellular nucleotides. These ectoenzymes possess ATPase and ATP pyrophosphatase activities and are type II transmembrane proteins. Expression of the related rat mRNA has been found in a subset of immature glial cells and in the alimentary tract. The corresponding rat protein has been detected in the pancreas, small intestine, colon, and liver. The human mRNA is expressed in glioma cells, prostate, and uterus. Expression of the human protein has been detected in uterus, basophils, and mast cells. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knockout allele exhibit increased numbers of basophils and mast cells with increased susceptibility to chronic allergic responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	C	T	3: 36,969,221	T2233I	possibly damaging	Het
9430038I01Rik	T	C	7: 137,387,292		probably benign	Het
Abhd14a	A	T	9: 106,443,951		probably null	Het
Actn2	T	C	13: 12,340,497	N2D	probably benign	Het
Adcy9	T	C	16: 4,311,567	E722G	probably damaging	Het
Alox12	C	A	11: 70,242,783	V572L	possibly damaging	Het
Ankrd11	T	C	8: 122,889,749	I2434V	possibly damaging	Het
Anks1	T	A	17: 27,991,447		probably null	Het
Bpifa3	T	A	2: 154,136,321	S148T	probably damaging	Het
Bptf	C	T	11: 107,035,864		probably benign	Het
Cabin1	A	T	10: 75,657,839	L1655H	probably damaging	Het
Ccdc13	G	T	9: 121,827,235	Q171K	probably benign	Het
Ccdc33	T	A	9: 58,117,478	Q155L	possibly damaging	Het
Cckbr	G	A	7: 105,470,619	G280E	probably benign	Het
Cdk11b	G	A	4: 155,648,240		probably benign	Het
Celsr1	G	T	15: 85,919,038		probably null	Het
Cenpj	A	T	14: 56,564,066	I150N	possibly damaging	Het
Cep135	C	A	5: 76,640,890	A1110E	possibly damaging	Het
Chit1	C	A	1: 134,146,626	H224N	probably damaging	Het
Cul5	T	C	9: 53,622,793	R680G	probably damaging	Het
Dhx58	C	A	11: 100,702,209	R224L	probably damaging	Het
Dlx1	C	A	2: 71,531,009	N122K	probably damaging	Het
Dnah5	A	C	15: 28,234,282	D279A	probably damaging	Het
Ercc5	A	G	1: 44,173,406	T675A	probably benign	Het
Farsa	T	A	8: 84,864,432		probably null	Het
Fbxw15	A	T	9: 109,555,252	V397D	probably damaging	Het
Fcrl5	G	A	3: 87,442,103	V62I	probably benign	Het
Gart	A	G	16: 91,624,336	S815P	probably damaging	Het
Glrx5	A	G	12: 105,040,323	N111S	possibly damaging	Het
Gm10845	A	G	14: 79,863,174		noncoding transcript	Het
Gm11639	A	G	11: 104,687,549		probably benign	Het
Gm8882	A	G	6: 132,362,073	S61P	unknown	Het
Gm9925	T	A	18: 74,065,516		probably benign	Het
Gsdme	T	C	6: 50,227,359	N206S	probably benign	Het
Helz2	T	C	2: 181,231,050	S2459G	probably benign	Het
Hnrnpul1	A	G	7: 25,754,359	S93P	possibly damaging	Het
Ints2	A	T	11: 86,226,748	I716N	possibly damaging	Het
Lmnb2	G	A	10: 80,905,128	Q248*	probably null	Het
Map3k7cl	A	G	16: 87,570,321	I32V	probably benign	Het
Mfsd4b4	A	T	10: 39,892,470	I255N	probably benign	Het
Myh6	A	G	14: 54,950,508	I1163T	probably benign	Het
Nphs1	A	T	7: 30,466,115	T636S	possibly damaging	Het
Ntsr1	T	A	2: 180,500,788	L124Q	probably damaging	Het
Obscn	C	T	11: 59,122,619		probably null	Het
P4ha2	G	A	11: 54,126,412		probably null	Het
Pcdha9	T	A	18: 36,999,111	V411D	probably benign	Het
Pkhd1l1	A	T	15: 44,525,988	I1380F	probably damaging	Het
Plekha1	T	C	7: 130,892,253	V106A	probably benign	Het
Plekhm1	A	T	11: 103,376,691	V818E	possibly damaging	Het
Pprc1	T	G	19: 46,065,370		probably benign	Het
Prmt9	T	C	8: 77,561,018		probably benign	Het
Rab26	T	C	17: 24,530,399	N193D	possibly damaging	Het
Rnf111	A	G	9: 70,429,580	S942P	probably damaging	Het
Scgb2b18	T	C	7: 33,173,225	T52A	probably damaging	Het
Syt3	C	T	7: 44,392,763	Q349*	probably null	Het
Tas2r107	T	C	6: 131,659,780	N102S	probably benign	Het
Tas2r126	T	A	6: 42,435,000	Y156N	possibly damaging	Het
Tcaf2	A	T	6: 42,642,778	I105N	probably benign	Het
Tet1	A	C	10: 62,879,773	M81R	probably benign	Het
Togaram2	T	C	17: 71,729,205	Y897H	probably damaging	Het
Trerf1	A	T	17: 47,314,271		noncoding transcript	Het
Ttn	G	A	2: 76,761,235	T12703I	probably damaging	Het
Unc79	A	G	12: 103,125,626	K1735E	possibly damaging	Het
Usp54	G	A	14: 20,583,351	T372I	possibly damaging	Het
Wdr24	T	C	17: 25,827,128	S476P	probably benign	Het
Wdr78	G	A	4: 103,049,589	P676S	probably benign	Het
Zbtb1	T	C	12: 76,386,275	I345T	possibly damaging	Het
Zcrb1	T	A	15: 93,395,615	I29L	probably benign	Het
Zfp341	T	A	2: 154,630,441	C315S	probably damaging	Het
Zfp623	C	A	15: 75,948,163	R323S	probably benign	Het
Zfp831	T	A	2: 174,644,092	Y187N	possibly damaging	Het

Other mutations in Enpp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00519:Enpp3	APN	10	24787772	missense	probably benign	0.00
IGL00778:Enpp3	APN	10	24798262	missense	probably damaging	1.00
IGL01147:Enpp3	APN	10	24774907	missense	probably damaging	1.00
IGL01343:Enpp3	APN	10	24805922	nonsense	probably null
IGL01642:Enpp3	APN	10	24798269	missense	probably damaging	1.00
IGL01814:Enpp3	APN	10	24792025	missense	possibly damaging	0.68
IGL02083:Enpp3	APN	10	24776794	missense	probably damaging	1.00
IGL02152:Enpp3	APN	10	24774002	missense	probably damaging	1.00
IGL02186:Enpp3	APN	10	24791983	splice site	probably benign
IGL02517:Enpp3	APN	10	24809848	splice site	probably benign
IGL02956:Enpp3	APN	10	24774943	splice site	probably benign
R0017:Enpp3	UTSW	10	24799153	splice site	probably null
R0042:Enpp3	UTSW	10	24774824	missense	probably damaging	1.00
R0110:Enpp3	UTSW	10	24776781	missense	probably damaging	1.00
R0218:Enpp3	UTSW	10	24776869	missense	possibly damaging	0.80
R0403:Enpp3	UTSW	10	24804436	missense	probably damaging	1.00
R0433:Enpp3	UTSW	10	24820597	missense	probably benign	0.00
R0450:Enpp3	UTSW	10	24776781	missense	probably damaging	1.00
R0510:Enpp3	UTSW	10	24776781	missense	probably damaging	1.00
R0826:Enpp3	UTSW	10	24795716	missense	probably damaging	1.00
R1245:Enpp3	UTSW	10	24784953	splice site	probably benign
R1261:Enpp3	UTSW	10	24774934	missense	probably damaging	0.97
R1633:Enpp3	UTSW	10	24795782	missense	probably damaging	1.00
R1903:Enpp3	UTSW	10	24778789	missense	probably damaging	1.00
R1913:Enpp3	UTSW	10	24776771	nonsense	probably null
R1966:Enpp3	UTSW	10	24807491	missense	probably damaging	0.99
R2157:Enpp3	UTSW	10	24776878	missense	probably damaging	1.00
R2179:Enpp3	UTSW	10	24805895	missense	probably benign	0.00
R2380:Enpp3	UTSW	10	24776872	missense	probably benign
R2410:Enpp3	UTSW	10	24774818	missense	probably benign	0.00
R3794:Enpp3	UTSW	10	24831732	splice site	probably null
R3896:Enpp3	UTSW	10	24777949	missense	possibly damaging	0.79
R4334:Enpp3	UTSW	10	24793589	missense	probably damaging	1.00
R4569:Enpp3	UTSW	10	24776882	missense	probably damaging	1.00
R4766:Enpp3	UTSW	10	24773927	missense	probably damaging	1.00
R4951:Enpp3	UTSW	10	24798277	missense	probably damaging	1.00
R4998:Enpp3	UTSW	10	24807538	missense	probably benign	0.01
R5045:Enpp3	UTSW	10	24776767	missense	probably damaging	1.00
R5276:Enpp3	UTSW	10	24809916	missense	probably damaging	1.00
R5331:Enpp3	UTSW	10	24808160	missense	probably damaging	1.00
R5569:Enpp3	UTSW	10	24778821	missense	probably damaging	0.98
R6117:Enpp3	UTSW	10	24787852	missense	probably damaging	1.00
R6419:Enpp3	UTSW	10	24808191	missense	probably damaging	1.00
R6677:Enpp3	UTSW	10	24777957	missense	possibly damaging	0.88
R6735:Enpp3	UTSW	10	24807453	missense	probably damaging	1.00
R6833:Enpp3	UTSW	10	24809870	missense	probably damaging	1.00
R6999:Enpp3	UTSW	10	24808166	missense	probably damaging	1.00
R7022:Enpp3	UTSW	10	24826195	missense	probably damaging	0.99
R7173:Enpp3	UTSW	10	24774047	missense	probably damaging	1.00
R7224:Enpp3	UTSW	10	24776884	missense	possibly damaging	0.63
R7227:Enpp3	UTSW	10	24817844	missense	unknown
R7487:Enpp3	UTSW	10	24805923	missense	probably benign	0.02
R7529:Enpp3	UTSW	10	24798174	missense	probably damaging	0.97
R7583:Enpp3	UTSW	10	24836092	start codon destroyed	probably null	0.83
R7692:Enpp3	UTSW	10	24784841	nonsense	probably null
R7962:Enpp3	UTSW	10	24784854	missense	probably damaging	1.00
R7965:Enpp3	UTSW	10	24778819	missense	possibly damaging	0.90
R8153:Enpp3	UTSW	10	24809879	missense	probably damaging	1.00
R8262:Enpp3	UTSW	10	24777926	missense	probably damaging	1.00
R8305:Enpp3	UTSW	10	24824929	critical splice acceptor site	probably null
R8393:Enpp3	UTSW	10	24826241	missense	probably damaging	1.00
R8776:Enpp3	UTSW	10	24774835	missense	probably damaging	1.00
R8776-TAIL:Enpp3	UTSW	10	24774835	missense	probably damaging	1.00
R8962:Enpp3	UTSW	10	24820615	missense	probably benign	0.12
R9047:Enpp3	UTSW	10	24798274	missense	possibly damaging	0.83
R9093:Enpp3	UTSW	10	24795804	missense	probably benign	0.00
R9117:Enpp3	UTSW	10	24826180	missense	possibly damaging	0.67
R9194:Enpp3	UTSW	10	24799194	missense	possibly damaging	0.90
R9224:Enpp3	UTSW	10	24774818	missense	probably benign	0.00
R9244:Enpp3	UTSW	10	24778791	missense	probably damaging	1.00
R9387:Enpp3	UTSW	10	24836092	start codon destroyed	probably null	0.83
R9644:Enpp3	UTSW	10	24809903	missense	probably damaging	0.98
R9658:Enpp3	UTSW	10	24773904	makesense	probably null
X0026:Enpp3	UTSW	10	24826242	missense	probably damaging	1.00
Z1176:Enpp3	UTSW	10	24787793	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GTTTACATATGCAGATGCGCG -3'
(R):5'- TGCCATTTCCTTAATGCCAAG -3'

Sequencing Primer
(F):5'- GCAGATGCGCGTTTAATATTAATTC -3'
(R):5'- ATGCCAAGCTATAAAACAAAAAGAC -3'

Posted On

2017-03-31