Mutagenetix > Incidental Mutation

Incidental Mutation 'R5975:Cabin1'

471701

Institutional Source

Beutler Lab

Gene Symbol

Cabin1

Ensembl Gene

ENSMUSG00000020196

Gene Name

calcineurin binding protein 1

Synonyms

Cain, Ppp3in, A330070M20Rik

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5975 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

75646112-75764341 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 75657839 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Histidine at position 1655 (L1655H)

Ref Sequence

ENSEMBL: ENSMUSP00000001712 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001712]

AlphaFold

G3X8Q1

Predicted Effect

probably damaging
Transcript: ENSMUST00000001712
AA Change: L1655H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000001712
Gene: ENSMUSG00000020196
AA Change: L1655H

Domain	Start	End	E-Value	Type
low complexity region	61	71	N/A	INTRINSIC
TPR	90	123	4.15e-2	SMART
TPR	124	157	5.69e0	SMART
low complexity region	312	326	N/A	INTRINSIC
low complexity region	365	381	N/A	INTRINSIC
TPR	615	648	9.7e0	SMART
low complexity region	740	750	N/A	INTRINSIC
low complexity region	882	892	N/A	INTRINSIC
TPR	1055	1088	6.92e1	SMART
low complexity region	1327	1349	N/A	INTRINSIC
low complexity region	1714	1727	N/A	INTRINSIC
low complexity region	1778	1790	N/A	INTRINSIC
low complexity region	1791	1803	N/A	INTRINSIC
low complexity region	1810	1831	N/A	INTRINSIC
low complexity region	1941	1956	N/A	INTRINSIC
Pfam:MEF2_binding	2123	2157	5.7e-26	PFAM
low complexity region	2165	2183	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217664

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218814

Meta Mutation Damage Score

0.8125

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.8%
20x: 93.3%

Validation Efficiency

98% (80/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calcineurin plays an important role in the T-cell receptor-mediated signal transduction pathway. The protein encoded by this gene binds specifically to the activated form of calcineurin and inhibits calcineurin-mediated signal transduction. The encoded protein is found in the nucleus and contains a leucine zipper domain as well as several PEST motifs, sequences which confer targeted degradation to those proteins which contain them. Alternative splicing results in multiple transcript variants encoding two different isoforms. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous null mutants exhibit embryonic lethality during organogenesis. Mice producing a truncated protein exhibit elevated levels of serum IgG1, IgG2b and IgE, produce more IgG1 in response to T-cell dependent antigen, and have enhanced expression of cytokines in response to anti-CD3 stimulation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	C	T	3: 36,969,221	T2233I	possibly damaging	Het
9430038I01Rik	T	C	7: 137,387,292		probably benign	Het
Abhd14a	A	T	9: 106,443,951		probably null	Het
Actn2	T	C	13: 12,340,497	N2D	probably benign	Het
Adcy9	T	C	16: 4,311,567	E722G	probably damaging	Het
Alox12	C	A	11: 70,242,783	V572L	possibly damaging	Het
Ankrd11	T	C	8: 122,889,749	I2434V	possibly damaging	Het
Anks1	T	A	17: 27,991,447		probably null	Het
Bpifa3	T	A	2: 154,136,321	S148T	probably damaging	Het
Bptf	C	T	11: 107,035,864		probably benign	Het
Ccdc13	G	T	9: 121,827,235	Q171K	probably benign	Het
Ccdc33	T	A	9: 58,117,478	Q155L	possibly damaging	Het
Cckbr	G	A	7: 105,470,619	G280E	probably benign	Het
Cdk11b	G	A	4: 155,648,240		probably benign	Het
Celsr1	G	T	15: 85,919,038		probably null	Het
Cenpj	A	T	14: 56,564,066	I150N	possibly damaging	Het
Cep135	C	A	5: 76,640,890	A1110E	possibly damaging	Het
Chit1	C	A	1: 134,146,626	H224N	probably damaging	Het
Cul5	T	C	9: 53,622,793	R680G	probably damaging	Het
Dhx58	C	A	11: 100,702,209	R224L	probably damaging	Het
Dlx1	C	A	2: 71,531,009	N122K	probably damaging	Het
Dnah5	A	C	15: 28,234,282	D279A	probably damaging	Het
Enpp3	A	G	10: 24,774,842	W799R	probably benign	Het
Ercc5	A	G	1: 44,173,406	T675A	probably benign	Het
Farsa	T	A	8: 84,864,432		probably null	Het
Fbxw15	A	T	9: 109,555,252	V397D	probably damaging	Het
Fcrl5	G	A	3: 87,442,103	V62I	probably benign	Het
Gart	A	G	16: 91,624,336	S815P	probably damaging	Het
Glrx5	A	G	12: 105,040,323	N111S	possibly damaging	Het
Gm10845	A	G	14: 79,863,174		noncoding transcript	Het
Gm11639	A	G	11: 104,687,549		probably benign	Het
Gm8882	A	G	6: 132,362,073	S61P	unknown	Het
Gm9925	T	A	18: 74,065,516		probably benign	Het
Gsdme	T	C	6: 50,227,359	N206S	probably benign	Het
Helz2	T	C	2: 181,231,050	S2459G	probably benign	Het
Hnrnpul1	A	G	7: 25,754,359	S93P	possibly damaging	Het
Ints2	A	T	11: 86,226,748	I716N	possibly damaging	Het
Lmnb2	G	A	10: 80,905,128	Q248*	probably null	Het
Map3k7cl	A	G	16: 87,570,321	I32V	probably benign	Het
Mfsd4b4	A	T	10: 39,892,470	I255N	probably benign	Het
Myh6	A	G	14: 54,950,508	I1163T	probably benign	Het
Nphs1	A	T	7: 30,466,115	T636S	possibly damaging	Het
Ntsr1	T	A	2: 180,500,788	L124Q	probably damaging	Het
Obscn	C	T	11: 59,122,619		probably null	Het
P4ha2	G	A	11: 54,126,412		probably null	Het
Pcdha9	T	A	18: 36,999,111	V411D	probably benign	Het
Pkhd1l1	A	T	15: 44,525,988	I1380F	probably damaging	Het
Plekha1	T	C	7: 130,892,253	V106A	probably benign	Het
Plekhm1	A	T	11: 103,376,691	V818E	possibly damaging	Het
Pprc1	T	G	19: 46,065,370		probably benign	Het
Prmt9	T	C	8: 77,561,018		probably benign	Het
Rab26	T	C	17: 24,530,399	N193D	possibly damaging	Het
Rnf111	A	G	9: 70,429,580	S942P	probably damaging	Het
Scgb2b18	T	C	7: 33,173,225	T52A	probably damaging	Het
Syt3	C	T	7: 44,392,763	Q349*	probably null	Het
Tas2r107	T	C	6: 131,659,780	N102S	probably benign	Het
Tas2r126	T	A	6: 42,435,000	Y156N	possibly damaging	Het
Tcaf2	A	T	6: 42,642,778	I105N	probably benign	Het
Tet1	A	C	10: 62,879,773	M81R	probably benign	Het
Togaram2	T	C	17: 71,729,205	Y897H	probably damaging	Het
Trerf1	A	T	17: 47,314,271		noncoding transcript	Het
Ttn	G	A	2: 76,761,235	T12703I	probably damaging	Het
Unc79	A	G	12: 103,125,626	K1735E	possibly damaging	Het
Usp54	G	A	14: 20,583,351	T372I	possibly damaging	Het
Wdr24	T	C	17: 25,827,128	S476P	probably benign	Het
Wdr78	G	A	4: 103,049,589	P676S	probably benign	Het
Zbtb1	T	C	12: 76,386,275	I345T	possibly damaging	Het
Zcrb1	T	A	15: 93,395,615	I29L	probably benign	Het
Zfp341	T	A	2: 154,630,441	C315S	probably damaging	Het
Zfp623	C	A	15: 75,948,163	R323S	probably benign	Het
Zfp831	T	A	2: 174,644,092	Y187N	possibly damaging	Het

Other mutations in Cabin1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01434:Cabin1	APN	10	75725586	missense	possibly damaging	0.58
IGL01457:Cabin1	APN	10	75742429	missense	probably damaging	0.96
IGL02217:Cabin1	APN	10	75700047	missense	possibly damaging	0.95
IGL02649:Cabin1	APN	10	75737418	missense	probably damaging	1.00
IGL02737:Cabin1	APN	10	75713585	missense	probably benign	0.09
IGL02792:Cabin1	APN	10	75746739	missense	probably damaging	1.00
IGL03047:Cabin1	APN	10	75700100	splice site	probably benign
IGL03106:Cabin1	APN	10	75733628	missense	probably benign	0.01
IGL03276:Cabin1	APN	10	75732413	missense	probably damaging	1.00
bison	UTSW	10	75684323	missense	probably damaging	1.00
range	UTSW	10	75658647	missense	probably damaging	1.00
R0335:Cabin1	UTSW	10	75657049	missense	probably damaging	1.00
R0557:Cabin1	UTSW	10	75726917	missense	probably damaging	1.00
R0578:Cabin1	UTSW	10	75713610	missense	probably damaging	0.96
R0588:Cabin1	UTSW	10	75745337	missense	possibly damaging	0.71
R1115:Cabin1	UTSW	10	75717677	missense	possibly damaging	0.70
R1120:Cabin1	UTSW	10	75725716	missense	probably damaging	1.00
R1439:Cabin1	UTSW	10	75656806	missense	probably damaging	1.00
R1471:Cabin1	UTSW	10	75694792	missense	probably damaging	1.00
R1794:Cabin1	UTSW	10	75725745	missense	possibly damaging	0.52
R1844:Cabin1	UTSW	10	75743350	splice site	probably null
R1959:Cabin1	UTSW	10	75735090	missense	possibly damaging	0.92
R2008:Cabin1	UTSW	10	75734976	splice site	probably null
R2279:Cabin1	UTSW	10	75753461	missense	probably benign
R3150:Cabin1	UTSW	10	75656911	missense	probably damaging	1.00
R3929:Cabin1	UTSW	10	75751618	critical splice acceptor site	probably null
R3945:Cabin1	UTSW	10	75745259	missense	probably damaging	1.00
R3946:Cabin1	UTSW	10	75745259	missense	probably damaging	1.00
R4206:Cabin1	UTSW	10	75754841	missense	possibly damaging	0.69
R4812:Cabin1	UTSW	10	75646594	missense	possibly damaging	0.93
R4944:Cabin1	UTSW	10	75721363	missense	probably damaging	1.00
R4944:Cabin1	UTSW	10	75739421	missense	probably damaging	0.99
R5078:Cabin1	UTSW	10	75721478	missense	probably damaging	1.00
R5082:Cabin1	UTSW	10	75738330	missense	probably damaging	0.99
R5319:Cabin1	UTSW	10	75725715	missense	probably damaging	1.00
R5481:Cabin1	UTSW	10	75735066	missense	probably benign	0.29
R5504:Cabin1	UTSW	10	75653009	missense	probably benign	0.00
R5710:Cabin1	UTSW	10	75647018	missense	probably benign	0.00
R5908:Cabin1	UTSW	10	75721532	missense	probably damaging	1.00
R5982:Cabin1	UTSW	10	75725560	missense	probably benign	0.00
R6038:Cabin1	UTSW	10	75739366	missense	probably benign	0.02
R6038:Cabin1	UTSW	10	75739366	missense	probably benign	0.02
R6114:Cabin1	UTSW	10	75747971	missense	probably benign	0.00
R6285:Cabin1	UTSW	10	75684323	missense	probably damaging	1.00
R6341:Cabin1	UTSW	10	75658739	missense	probably damaging	0.98
R6361:Cabin1	UTSW	10	75726865	missense	possibly damaging	0.91
R6395:Cabin1	UTSW	10	75746742	missense	probably benign	0.10
R6422:Cabin1	UTSW	10	75656792	missense	probably damaging	1.00
R6575:Cabin1	UTSW	10	75725701	missense	possibly damaging	0.90
R6763:Cabin1	UTSW	10	75746730	missense	probably damaging	0.99
R6845:Cabin1	UTSW	10	75721508	missense	probably damaging	1.00
R6936:Cabin1	UTSW	10	75715758	splice site	probably null
R7050:Cabin1	UTSW	10	75713542	missense	probably damaging	1.00
R7055:Cabin1	UTSW	10	75743283	missense	probably benign	0.04
R7101:Cabin1	UTSW	10	75751567	missense	probably benign
R7138:Cabin1	UTSW	10	75745353	missense	probably damaging	0.98
R7173:Cabin1	UTSW	10	75746562	missense	probably benign	0.00
R7265:Cabin1	UTSW	10	75721423	missense
R7284:Cabin1	UTSW	10	75694834	missense
R7472:Cabin1	UTSW	10	75658647	missense	probably damaging	1.00
R7571:Cabin1	UTSW	10	75646666	missense	probably damaging	1.00
R7617:Cabin1	UTSW	10	75732443	missense	possibly damaging	0.85
R7739:Cabin1	UTSW	10	75658658	missense	probably damaging	1.00
R7997:Cabin1	UTSW	10	75733775	missense	probably benign	0.01
R8347:Cabin1	UTSW	10	75742367	missense	probably damaging	0.98
R8544:Cabin1	UTSW	10	75750056	missense	probably benign	0.17
R8546:Cabin1	UTSW	10	75742267	missense	probably damaging	1.00
R8692:Cabin1	UTSW	10	75751576	missense	probably benign	0.28
R8839:Cabin1	UTSW	10	75656816	missense	probably benign	0.00
R9010:Cabin1	UTSW	10	75735058	nonsense	probably null
R9108:Cabin1	UTSW	10	75657139	missense	possibly damaging	0.94
R9204:Cabin1	UTSW	10	75694716	missense	probably benign	0.01
R9259:Cabin1	UTSW	10	75746742	missense	probably benign
R9312:Cabin1	UTSW	10	75725735	missense	probably benign	0.07
R9421:Cabin1	UTSW	10	75657824	missense	probably damaging	1.00
R9439:Cabin1	UTSW	10	75745235	missense	probably damaging	1.00
R9578:Cabin1	UTSW	10	75754351	missense	probably damaging	0.99
R9645:Cabin1	UTSW	10	75658709	missense	probably benign	0.36
R9649:Cabin1	UTSW	10	75739405	missense	probably damaging	0.98
R9711:Cabin1	UTSW	10	75743256	missense	probably benign	0.02
Z1177:Cabin1	UTSW	10	75648123	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TTTGCGATGTGAGCCTTACG -3'
(R):5'- ACTGGGACCAAGTCAGAGAC -3'

Sequencing Primer
(F):5'- CCTTACGGGGAGCTGACATCAAG -3'
(R):5'- TATGATCCAAAGAGCACTTTAGGG -3'

Posted On

2017-03-31