Mutagenetix > Incidental Mutation

Incidental Mutation 'R5975:Ints2'

471706

Institutional Source

Beutler Lab

Gene Symbol

Ints2

Ensembl Gene

ENSMUSG00000018068

Gene Name

integrator complex subunit 2

Synonyms

2810417D08Rik

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5975 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

86210681-86257575 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 86226748 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 716 (I716N)

Ref Sequence

ENSEMBL: ENSMUSP00000103674 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018212] [ENSMUST00000108039]

AlphaFold

Q80UK8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000018212
AA Change: I716N

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000018212
Gene: ENSMUSG00000018068
AA Change: I716N

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	1131	N/A	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000108039
AA Change: I716N

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000103674
Gene: ENSMUSG00000018068
AA Change: I716N

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	1132	N/A	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000134828
AA Change: I29N

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143819

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146421

Meta Mutation Damage Score

0.3387

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.8%
20x: 93.3%

Validation Efficiency

98% (80/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS2 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	C	T	3: 36,969,221	T2233I	possibly damaging	Het
9430038I01Rik	T	C	7: 137,387,292		probably benign	Het
Abhd14a	A	T	9: 106,443,951		probably null	Het
Actn2	T	C	13: 12,340,497	N2D	probably benign	Het
Adcy9	T	C	16: 4,311,567	E722G	probably damaging	Het
Alox12	C	A	11: 70,242,783	V572L	possibly damaging	Het
Ankrd11	T	C	8: 122,889,749	I2434V	possibly damaging	Het
Anks1	T	A	17: 27,991,447		probably null	Het
Bpifa3	T	A	2: 154,136,321	S148T	probably damaging	Het
Bptf	C	T	11: 107,035,864		probably benign	Het
Cabin1	A	T	10: 75,657,839	L1655H	probably damaging	Het
Ccdc13	G	T	9: 121,827,235	Q171K	probably benign	Het
Ccdc33	T	A	9: 58,117,478	Q155L	possibly damaging	Het
Cckbr	G	A	7: 105,470,619	G280E	probably benign	Het
Cdk11b	G	A	4: 155,648,240		probably benign	Het
Celsr1	G	T	15: 85,919,038		probably null	Het
Cenpj	A	T	14: 56,564,066	I150N	possibly damaging	Het
Cep135	C	A	5: 76,640,890	A1110E	possibly damaging	Het
Chit1	C	A	1: 134,146,626	H224N	probably damaging	Het
Cul5	T	C	9: 53,622,793	R680G	probably damaging	Het
Dhx58	C	A	11: 100,702,209	R224L	probably damaging	Het
Dlx1	C	A	2: 71,531,009	N122K	probably damaging	Het
Dnah5	A	C	15: 28,234,282	D279A	probably damaging	Het
Enpp3	A	G	10: 24,774,842	W799R	probably benign	Het
Ercc5	A	G	1: 44,173,406	T675A	probably benign	Het
Farsa	T	A	8: 84,864,432		probably null	Het
Fbxw15	A	T	9: 109,555,252	V397D	probably damaging	Het
Fcrl5	G	A	3: 87,442,103	V62I	probably benign	Het
Gart	A	G	16: 91,624,336	S815P	probably damaging	Het
Glrx5	A	G	12: 105,040,323	N111S	possibly damaging	Het
Gm10845	A	G	14: 79,863,174		noncoding transcript	Het
Gm11639	A	G	11: 104,687,549		probably benign	Het
Gm8882	A	G	6: 132,362,073	S61P	unknown	Het
Gm9925	T	A	18: 74,065,516		probably benign	Het
Gsdme	T	C	6: 50,227,359	N206S	probably benign	Het
Helz2	T	C	2: 181,231,050	S2459G	probably benign	Het
Hnrnpul1	A	G	7: 25,754,359	S93P	possibly damaging	Het
Lmnb2	G	A	10: 80,905,128	Q248*	probably null	Het
Map3k7cl	A	G	16: 87,570,321	I32V	probably benign	Het
Mfsd4b4	A	T	10: 39,892,470	I255N	probably benign	Het
Myh6	A	G	14: 54,950,508	I1163T	probably benign	Het
Nphs1	A	T	7: 30,466,115	T636S	possibly damaging	Het
Ntsr1	T	A	2: 180,500,788	L124Q	probably damaging	Het
Obscn	C	T	11: 59,122,619		probably null	Het
P4ha2	G	A	11: 54,126,412		probably null	Het
Pcdha9	T	A	18: 36,999,111	V411D	probably benign	Het
Pkhd1l1	A	T	15: 44,525,988	I1380F	probably damaging	Het
Plekha1	T	C	7: 130,892,253	V106A	probably benign	Het
Plekhm1	A	T	11: 103,376,691	V818E	possibly damaging	Het
Pprc1	T	G	19: 46,065,370		probably benign	Het
Prmt9	T	C	8: 77,561,018		probably benign	Het
Rab26	T	C	17: 24,530,399	N193D	possibly damaging	Het
Rnf111	A	G	9: 70,429,580	S942P	probably damaging	Het
Scgb2b18	T	C	7: 33,173,225	T52A	probably damaging	Het
Syt3	C	T	7: 44,392,763	Q349*	probably null	Het
Tas2r107	T	C	6: 131,659,780	N102S	probably benign	Het
Tas2r126	T	A	6: 42,435,000	Y156N	possibly damaging	Het
Tcaf2	A	T	6: 42,642,778	I105N	probably benign	Het
Tet1	A	C	10: 62,879,773	M81R	probably benign	Het
Togaram2	T	C	17: 71,729,205	Y897H	probably damaging	Het
Trerf1	A	T	17: 47,314,271		noncoding transcript	Het
Ttn	G	A	2: 76,761,235	T12703I	probably damaging	Het
Unc79	A	G	12: 103,125,626	K1735E	possibly damaging	Het
Usp54	G	A	14: 20,583,351	T372I	possibly damaging	Het
Wdr24	T	C	17: 25,827,128	S476P	probably benign	Het
Wdr78	G	A	4: 103,049,589	P676S	probably benign	Het
Zbtb1	T	C	12: 76,386,275	I345T	possibly damaging	Het
Zcrb1	T	A	15: 93,395,615	I29L	probably benign	Het
Zfp341	T	A	2: 154,630,441	C315S	probably damaging	Het
Zfp623	C	A	15: 75,948,163	R323S	probably benign	Het
Zfp831	T	A	2: 174,644,092	Y187N	possibly damaging	Het

Other mutations in Ints2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00807:Ints2	APN	11	86233135	missense	probably damaging	1.00
IGL02490:Ints2	APN	11	86233183	missense	possibly damaging	0.93
IGL02612:Ints2	APN	11	86215578	missense	probably damaging	1.00
IGL03396:Ints2	APN	11	86213062	missense	probably damaging	0.99
R0015:Ints2	UTSW	11	86249287	missense	probably damaging	1.00
R0015:Ints2	UTSW	11	86249287	missense	probably damaging	1.00
R0355:Ints2	UTSW	11	86234749	missense	probably benign	0.00
R0389:Ints2	UTSW	11	86248851	missense	probably damaging	1.00
R0631:Ints2	UTSW	11	86233196	missense	probably benign	0.02
R0944:Ints2	UTSW	11	86244463	missense	possibly damaging	0.85
R1268:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1269:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1270:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1396:Ints2	UTSW	11	86249248	missense	probably damaging	0.98
R1474:Ints2	UTSW	11	86226781	missense	probably damaging	0.97
R1503:Ints2	UTSW	11	86226781	missense	probably damaging	0.97
R1840:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1987:Ints2	UTSW	11	86217800	missense	probably benign	0.03
R1990:Ints2	UTSW	11	86248934	missense	possibly damaging	0.58
R1991:Ints2	UTSW	11	86248934	missense	possibly damaging	0.58
R3694:Ints2	UTSW	11	86243001	missense	probably benign	0.41
R4056:Ints2	UTSW	11	86242952	missense	probably damaging	1.00
R4057:Ints2	UTSW	11	86242952	missense	probably damaging	1.00
R4569:Ints2	UTSW	11	86256198	missense	probably damaging	1.00
R4585:Ints2	UTSW	11	86249275	missense	probably damaging	1.00
R4586:Ints2	UTSW	11	86249275	missense	probably damaging	1.00
R4806:Ints2	UTSW	11	86256209	missense	probably benign	0.10
R4929:Ints2	UTSW	11	86212653	missense	possibly damaging	0.56
R5031:Ints2	UTSW	11	86256200	missense	probably damaging	1.00
R5064:Ints2	UTSW	11	86249274	missense	probably damaging	1.00
R5270:Ints2	UTSW	11	86215795	missense	probably damaging	1.00
R5621:Ints2	UTSW	11	86242947	missense	probably benign	0.32
R5875:Ints2	UTSW	11	86238312	missense	probably benign	0.04
R5908:Ints2	UTSW	11	86215545	critical splice donor site	probably null
R5914:Ints2	UTSW	11	86222174	missense	probably benign	0.03
R5941:Ints2	UTSW	11	86250972	missense	probably benign	0.01
R6003:Ints2	UTSW	11	86238468	missense	probably damaging	1.00
R6091:Ints2	UTSW	11	86236603	missense	probably damaging	0.96
R6209:Ints2	UTSW	11	86225058	missense	probably damaging	1.00
R6567:Ints2	UTSW	11	86226661	missense	probably benign	0.42
R6764:Ints2	UTSW	11	86212779	missense	probably benign	0.00
R7033:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R7132:Ints2	UTSW	11	86217754	missense	probably benign	0.26
R7337:Ints2	UTSW	11	86217842	missense	probably benign	0.00
R7410:Ints2	UTSW	11	86233226	missense	probably benign	0.02
R7483:Ints2	UTSW	11	86215618	missense	probably damaging	1.00
R7503:Ints2	UTSW	11	86232055	missense	probably benign
R7804:Ints2	UTSW	11	86212663	missense	possibly damaging	0.92
R7845:Ints2	UTSW	11	86238263	missense	possibly damaging	0.93
R7875:Ints2	UTSW	11	86213062	missense	probably damaging	0.99
R7918:Ints2	UTSW	11	86222217	missense	probably damaging	1.00
R7922:Ints2	UTSW	11	86244627	missense	probably benign	0.29
R8058:Ints2	UTSW	11	86255353	missense	probably benign	0.05
R8134:Ints2	UTSW	11	86212660	missense	probably damaging	1.00
R8189:Ints2	UTSW	11	86215570	missense	probably damaging	1.00
R8295:Ints2	UTSW	11	86225088	missense	probably damaging	0.97
R8348:Ints2	UTSW	11	86255423	missense	probably benign
R8448:Ints2	UTSW	11	86255423	missense	probably benign
R8784:Ints2	UTSW	11	86222137	missense	probably damaging	1.00
R8784:Ints2	UTSW	11	86225115	nonsense	probably null
R8942:Ints2	UTSW	11	86212894	missense	probably benign	0.00
R9037:Ints2	UTSW	11	86215704	missense	probably benign
R9154:Ints2	UTSW	11	86234698	missense	probably damaging	1.00
R9397:Ints2	UTSW	11	86244485	missense	probably benign	0.01
R9412:Ints2	UTSW	11	86226763	missense	probably damaging	0.99
R9472:Ints2	UTSW	11	86242998	missense
R9476:Ints2	UTSW	11	86244509	missense	probably benign
R9510:Ints2	UTSW	11	86244509	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGTATAGGATTCCAGTCTGCCC -3'
(R):5'- ACAGCAAGTTTCCTTAACTCCC -3'

Sequencing Primer
(F):5'- CAGCCCCTCTGTACAGCAGTAG -3'
(R):5'- CTTAACTCCCGATGCTAGTGGG -3'

Posted On

2017-03-31