Incidental Mutation 'R5975:Ints2'
ID 471706
Institutional Source Beutler Lab
Gene Symbol Ints2
Ensembl Gene ENSMUSG00000018068
Gene Name integrator complex subunit 2
Synonyms 2810417D08Rik
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5975 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 86101507-86148401 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 86117574 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 716 (I716N)
Ref Sequence ENSEMBL: ENSMUSP00000103674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018212] [ENSMUST00000108039]
AlphaFold Q80UK8
Predicted Effect possibly damaging
Transcript: ENSMUST00000018212
AA Change: I716N

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000018212
Gene: ENSMUSG00000018068
AA Change: I716N

DomainStartEndE-ValueType
Pfam:INTS2 24 1131 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108039
AA Change: I716N

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103674
Gene: ENSMUSG00000018068
AA Change: I716N

DomainStartEndE-ValueType
Pfam:INTS2 24 1132 N/A PFAM
Predicted Effect unknown
Transcript: ENSMUST00000134828
AA Change: I29N
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143819
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146421
Meta Mutation Damage Score 0.3387 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 98% (80/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS2 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430038I01Rik T C 7: 136,989,021 (GRCm39) probably benign Het
Abhd14a A T 9: 106,321,150 (GRCm39) probably null Het
Actn2 T C 13: 12,355,378 (GRCm39) N2D probably benign Het
Adcy9 T C 16: 4,129,431 (GRCm39) E722G probably damaging Het
Alox12 C A 11: 70,133,609 (GRCm39) V572L possibly damaging Het
Ankrd11 T C 8: 123,616,488 (GRCm39) I2434V possibly damaging Het
Anks1 T A 17: 28,210,421 (GRCm39) probably null Het
Bltp1 C T 3: 37,023,370 (GRCm39) T2233I possibly damaging Het
Bpifa3 T A 2: 153,978,241 (GRCm39) S148T probably damaging Het
Bptf C T 11: 106,926,690 (GRCm39) probably benign Het
Cabin1 A T 10: 75,493,673 (GRCm39) L1655H probably damaging Het
Ccdc13 G T 9: 121,656,301 (GRCm39) Q171K probably benign Het
Ccdc33 T A 9: 58,024,761 (GRCm39) Q155L possibly damaging Het
Cckbr G A 7: 105,119,826 (GRCm39) G280E probably benign Het
Cdk11b G A 4: 155,732,697 (GRCm39) probably benign Het
Celsr1 G T 15: 85,803,239 (GRCm39) probably null Het
Cenpj A T 14: 56,801,523 (GRCm39) I150N possibly damaging Het
Cep135 C A 5: 76,788,737 (GRCm39) A1110E possibly damaging Het
Chit1 C A 1: 134,074,364 (GRCm39) H224N probably damaging Het
Cul5 T C 9: 53,534,093 (GRCm39) R680G probably damaging Het
Dhx58 C A 11: 100,593,035 (GRCm39) R224L probably damaging Het
Dlx1 C A 2: 71,361,353 (GRCm39) N122K probably damaging Het
Dnah5 A C 15: 28,234,428 (GRCm39) D279A probably damaging Het
Dnai4 G A 4: 102,906,786 (GRCm39) P676S probably benign Het
Efcab3 A G 11: 104,578,375 (GRCm39) probably benign Het
Enpp3 A G 10: 24,650,740 (GRCm39) W799R probably benign Het
Ercc5 A G 1: 44,212,566 (GRCm39) T675A probably benign Het
Farsa T A 8: 85,591,061 (GRCm39) probably null Het
Fbxw15 A T 9: 109,384,320 (GRCm39) V397D probably damaging Het
Fcrl5 G A 3: 87,349,410 (GRCm39) V62I probably benign Het
Gart A G 16: 91,421,224 (GRCm39) S815P probably damaging Het
Glrx5 A G 12: 105,006,582 (GRCm39) N111S possibly damaging Het
Gm10845 A G 14: 80,100,614 (GRCm39) noncoding transcript Het
Gm9925 T A 18: 74,198,587 (GRCm39) probably benign Het
Gsdme T C 6: 50,204,339 (GRCm39) N206S probably benign Het
Helz2 T C 2: 180,872,843 (GRCm39) S2459G probably benign Het
Hnrnpul1 A G 7: 25,453,784 (GRCm39) S93P possibly damaging Het
Lmnb2 G A 10: 80,740,962 (GRCm39) Q248* probably null Het
Map3k7cl A G 16: 87,367,209 (GRCm39) I32V probably benign Het
Mfsd4b4 A T 10: 39,768,466 (GRCm39) I255N probably benign Het
Myh6 A G 14: 55,187,965 (GRCm39) I1163T probably benign Het
Nphs1 A T 7: 30,165,540 (GRCm39) T636S possibly damaging Het
Ntsr1 T A 2: 180,142,581 (GRCm39) L124Q probably damaging Het
Obscn C T 11: 59,013,445 (GRCm39) probably null Het
P4ha2 G A 11: 54,017,238 (GRCm39) probably null Het
Pcdha9 T A 18: 37,132,164 (GRCm39) V411D probably benign Het
Pkhd1l1 A T 15: 44,389,384 (GRCm39) I1380F probably damaging Het
Plekha1 T C 7: 130,493,983 (GRCm39) V106A probably benign Het
Plekhm1 A T 11: 103,267,517 (GRCm39) V818E possibly damaging Het
Pprc1 T G 19: 46,053,809 (GRCm39) probably benign Het
Prb1c A G 6: 132,339,036 (GRCm39) S61P unknown Het
Prmt9 T C 8: 78,287,647 (GRCm39) probably benign Het
Rab26 T C 17: 24,749,373 (GRCm39) N193D possibly damaging Het
Rnf111 A G 9: 70,336,862 (GRCm39) S942P probably damaging Het
Scgb2b18 T C 7: 32,872,650 (GRCm39) T52A probably damaging Het
Syt3 C T 7: 44,042,187 (GRCm39) Q349* probably null Het
Tas2r107 T C 6: 131,636,743 (GRCm39) N102S probably benign Het
Tas2r126 T A 6: 42,411,934 (GRCm39) Y156N possibly damaging Het
Tcaf2 A T 6: 42,619,712 (GRCm39) I105N probably benign Het
Tet1 A C 10: 62,715,552 (GRCm39) M81R probably benign Het
Togaram2 T C 17: 72,036,200 (GRCm39) Y897H probably damaging Het
Trerf1 A T 17: 47,625,197 (GRCm39) noncoding transcript Het
Ttn G A 2: 76,591,579 (GRCm39) T12703I probably damaging Het
Unc79 A G 12: 103,091,885 (GRCm39) K1735E possibly damaging Het
Usp54 G A 14: 20,633,419 (GRCm39) T372I possibly damaging Het
Wdr24 T C 17: 26,046,102 (GRCm39) S476P probably benign Het
Zbtb1 T C 12: 76,433,049 (GRCm39) I345T possibly damaging Het
Zcrb1 T A 15: 93,293,496 (GRCm39) I29L probably benign Het
Zfp341 T A 2: 154,472,361 (GRCm39) C315S probably damaging Het
Zfp623 C A 15: 75,820,012 (GRCm39) R323S probably benign Het
Zfp831 T A 2: 174,485,885 (GRCm39) Y187N possibly damaging Het
Other mutations in Ints2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Ints2 APN 11 86,123,961 (GRCm39) missense probably damaging 1.00
IGL02490:Ints2 APN 11 86,124,009 (GRCm39) missense possibly damaging 0.93
IGL02612:Ints2 APN 11 86,106,404 (GRCm39) missense probably damaging 1.00
IGL03396:Ints2 APN 11 86,103,888 (GRCm39) missense probably damaging 0.99
R0015:Ints2 UTSW 11 86,140,113 (GRCm39) missense probably damaging 1.00
R0015:Ints2 UTSW 11 86,140,113 (GRCm39) missense probably damaging 1.00
R0355:Ints2 UTSW 11 86,125,575 (GRCm39) missense probably benign 0.00
R0389:Ints2 UTSW 11 86,139,677 (GRCm39) missense probably damaging 1.00
R0631:Ints2 UTSW 11 86,124,022 (GRCm39) missense probably benign 0.02
R0944:Ints2 UTSW 11 86,135,289 (GRCm39) missense possibly damaging 0.85
R1268:Ints2 UTSW 11 86,123,911 (GRCm39) missense probably damaging 1.00
R1269:Ints2 UTSW 11 86,123,911 (GRCm39) missense probably damaging 1.00
R1270:Ints2 UTSW 11 86,123,911 (GRCm39) missense probably damaging 1.00
R1396:Ints2 UTSW 11 86,140,074 (GRCm39) missense probably damaging 0.98
R1474:Ints2 UTSW 11 86,117,607 (GRCm39) missense probably damaging 0.97
R1503:Ints2 UTSW 11 86,117,607 (GRCm39) missense probably damaging 0.97
R1840:Ints2 UTSW 11 86,123,911 (GRCm39) missense probably damaging 1.00
R1987:Ints2 UTSW 11 86,108,626 (GRCm39) missense probably benign 0.03
R1990:Ints2 UTSW 11 86,139,760 (GRCm39) missense possibly damaging 0.58
R1991:Ints2 UTSW 11 86,139,760 (GRCm39) missense possibly damaging 0.58
R3694:Ints2 UTSW 11 86,133,827 (GRCm39) missense probably benign 0.41
R4056:Ints2 UTSW 11 86,133,778 (GRCm39) missense probably damaging 1.00
R4057:Ints2 UTSW 11 86,133,778 (GRCm39) missense probably damaging 1.00
R4569:Ints2 UTSW 11 86,147,024 (GRCm39) missense probably damaging 1.00
R4585:Ints2 UTSW 11 86,140,101 (GRCm39) missense probably damaging 1.00
R4586:Ints2 UTSW 11 86,140,101 (GRCm39) missense probably damaging 1.00
R4806:Ints2 UTSW 11 86,147,035 (GRCm39) missense probably benign 0.10
R4929:Ints2 UTSW 11 86,103,479 (GRCm39) missense possibly damaging 0.56
R5031:Ints2 UTSW 11 86,147,026 (GRCm39) missense probably damaging 1.00
R5064:Ints2 UTSW 11 86,140,100 (GRCm39) missense probably damaging 1.00
R5270:Ints2 UTSW 11 86,106,621 (GRCm39) missense probably damaging 1.00
R5621:Ints2 UTSW 11 86,133,773 (GRCm39) missense probably benign 0.32
R5875:Ints2 UTSW 11 86,129,138 (GRCm39) missense probably benign 0.04
R5908:Ints2 UTSW 11 86,106,371 (GRCm39) critical splice donor site probably null
R5914:Ints2 UTSW 11 86,113,000 (GRCm39) missense probably benign 0.03
R5941:Ints2 UTSW 11 86,141,798 (GRCm39) missense probably benign 0.01
R6003:Ints2 UTSW 11 86,129,294 (GRCm39) missense probably damaging 1.00
R6091:Ints2 UTSW 11 86,127,429 (GRCm39) missense probably damaging 0.96
R6209:Ints2 UTSW 11 86,115,884 (GRCm39) missense probably damaging 1.00
R6567:Ints2 UTSW 11 86,117,487 (GRCm39) missense probably benign 0.42
R6764:Ints2 UTSW 11 86,103,605 (GRCm39) missense probably benign 0.00
R7033:Ints2 UTSW 11 86,123,911 (GRCm39) missense probably damaging 1.00
R7132:Ints2 UTSW 11 86,108,580 (GRCm39) missense probably benign 0.26
R7337:Ints2 UTSW 11 86,108,668 (GRCm39) missense probably benign 0.00
R7410:Ints2 UTSW 11 86,124,052 (GRCm39) missense probably benign 0.02
R7483:Ints2 UTSW 11 86,106,444 (GRCm39) missense probably damaging 1.00
R7503:Ints2 UTSW 11 86,122,881 (GRCm39) missense probably benign
R7804:Ints2 UTSW 11 86,103,489 (GRCm39) missense possibly damaging 0.92
R7845:Ints2 UTSW 11 86,129,089 (GRCm39) missense possibly damaging 0.93
R7875:Ints2 UTSW 11 86,103,888 (GRCm39) missense probably damaging 0.99
R7918:Ints2 UTSW 11 86,113,043 (GRCm39) missense probably damaging 1.00
R7922:Ints2 UTSW 11 86,135,453 (GRCm39) missense probably benign 0.29
R8058:Ints2 UTSW 11 86,146,179 (GRCm39) missense probably benign 0.05
R8134:Ints2 UTSW 11 86,103,486 (GRCm39) missense probably damaging 1.00
R8189:Ints2 UTSW 11 86,106,396 (GRCm39) missense probably damaging 1.00
R8295:Ints2 UTSW 11 86,115,914 (GRCm39) missense probably damaging 0.97
R8348:Ints2 UTSW 11 86,146,249 (GRCm39) missense probably benign
R8448:Ints2 UTSW 11 86,146,249 (GRCm39) missense probably benign
R8784:Ints2 UTSW 11 86,115,941 (GRCm39) nonsense probably null
R8784:Ints2 UTSW 11 86,112,963 (GRCm39) missense probably damaging 1.00
R8942:Ints2 UTSW 11 86,103,720 (GRCm39) missense probably benign 0.00
R9037:Ints2 UTSW 11 86,106,530 (GRCm39) missense probably benign
R9154:Ints2 UTSW 11 86,125,524 (GRCm39) missense probably damaging 1.00
R9397:Ints2 UTSW 11 86,135,311 (GRCm39) missense probably benign 0.01
R9412:Ints2 UTSW 11 86,117,589 (GRCm39) missense probably damaging 0.99
R9472:Ints2 UTSW 11 86,133,824 (GRCm39) missense
R9476:Ints2 UTSW 11 86,135,335 (GRCm39) missense probably benign
R9510:Ints2 UTSW 11 86,135,335 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTATAGGATTCCAGTCTGCCC -3'
(R):5'- ACAGCAAGTTTCCTTAACTCCC -3'

Sequencing Primer
(F):5'- CAGCCCCTCTGTACAGCAGTAG -3'
(R):5'- CTTAACTCCCGATGCTAGTGGG -3'
Posted On 2017-03-31