Mutagenetix > Incidental Mutation

Incidental Mutation 'R5975:Celsr1'

471722

Institutional Source

Beutler Lab

Gene Symbol

Celsr1

Ensembl Gene

ENSMUSG00000016028

Gene Name

cadherin, EGF LAG seven-pass G-type receptor 1

Synonyms

crash, Crsh, Scy

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.686) question?

Stock #

R5975 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

85898929-86033777 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

G to T at 85919038 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000016172]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000016172

SMART Domains

Protein: ENSMUSP00000016172
Gene: ENSMUSG00000016028

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
low complexity region	65	93	N/A	INTRINSIC
low complexity region	221	240	N/A	INTRINSIC
low complexity region	243	257	N/A	INTRINSIC
CA	282	366	9.51e-26	SMART
CA	390	472	1.59e-27	SMART
CA	496	578	3.8e-25	SMART
CA	602	700	2.25e-27	SMART
CA	724	802	3.14e-17	SMART
CA	826	905	2.67e-29	SMART
CA	929	1012	3.23e-28	SMART
CA	1036	1114	4.17e-22	SMART
CA	1142	1218	6.89e-1	SMART
EGF	1321	1376	3.38e-3	SMART
EGF	1381	1414	5.49e-3	SMART
EGF	1421	1456	9.7e-4	SMART
LamG	1477	1644	2.53e-33	SMART
EGF	1667	1700	6.4e-4	SMART
LamG	1726	1864	1.13e-21	SMART
EGF	1890	1923	1.84e-4	SMART
EGF	1925	1961	5.49e-3	SMART
EGF_Lam	2018	2063	7.12e-11	SMART
HormR	2066	2128	2.55e-20	SMART
Pfam:GAIN	2140	2396	1.1e-64	PFAM
GPS	2422	2475	5.03e-22	SMART
Pfam:7tm_2	2480	2712	2.6e-60	PFAM
low complexity region	2738	2753	N/A	INTRINSIC
low complexity region	2819	2852	N/A	INTRINSIC
low complexity region	2976	2988	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000226840

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227450

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.8%
20x: 93.3%

Validation Efficiency

98% (80/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. This particular member is a developmentally regulated, neural-specific gene which plays an unspecified role in early embryogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice exhibit kinky tails, variable neural tube defects, abnormal hair follicle orientation, whorl-like hair patterns, and partial prenatal lethality. ENU-induced mutants show defects in planar polarity of inner ear hair cells and complete perinatal lethality due to craniorachischisis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	C	T	3: 36,969,221	T2233I	possibly damaging	Het
9430038I01Rik	T	C	7: 137,387,292		probably benign	Het
Abhd14a	A	T	9: 106,443,951		probably null	Het
Actn2	T	C	13: 12,340,497	N2D	probably benign	Het
Adcy9	T	C	16: 4,311,567	E722G	probably damaging	Het
Alox12	C	A	11: 70,242,783	V572L	possibly damaging	Het
Ankrd11	T	C	8: 122,889,749	I2434V	possibly damaging	Het
Anks1	T	A	17: 27,991,447		probably null	Het
Bpifa3	T	A	2: 154,136,321	S148T	probably damaging	Het
Bptf	C	T	11: 107,035,864		probably benign	Het
Cabin1	A	T	10: 75,657,839	L1655H	probably damaging	Het
Ccdc13	G	T	9: 121,827,235	Q171K	probably benign	Het
Ccdc33	T	A	9: 58,117,478	Q155L	possibly damaging	Het
Cckbr	G	A	7: 105,470,619	G280E	probably benign	Het
Cdk11b	G	A	4: 155,648,240		probably benign	Het
Cenpj	A	T	14: 56,564,066	I150N	possibly damaging	Het
Cep135	C	A	5: 76,640,890	A1110E	possibly damaging	Het
Chit1	C	A	1: 134,146,626	H224N	probably damaging	Het
Cul5	T	C	9: 53,622,793	R680G	probably damaging	Het
Dhx58	C	A	11: 100,702,209	R224L	probably damaging	Het
Dlx1	C	A	2: 71,531,009	N122K	probably damaging	Het
Dnah5	A	C	15: 28,234,282	D279A	probably damaging	Het
Enpp3	A	G	10: 24,774,842	W799R	probably benign	Het
Ercc5	A	G	1: 44,173,406	T675A	probably benign	Het
Farsa	T	A	8: 84,864,432		probably null	Het
Fbxw15	A	T	9: 109,555,252	V397D	probably damaging	Het
Fcrl5	G	A	3: 87,442,103	V62I	probably benign	Het
Gart	A	G	16: 91,624,336	S815P	probably damaging	Het
Glrx5	A	G	12: 105,040,323	N111S	possibly damaging	Het
Gm10845	A	G	14: 79,863,174		noncoding transcript	Het
Gm11639	A	G	11: 104,687,549		probably benign	Het
Gm8882	A	G	6: 132,362,073	S61P	unknown	Het
Gm9925	T	A	18: 74,065,516		probably benign	Het
Gsdme	T	C	6: 50,227,359	N206S	probably benign	Het
Helz2	T	C	2: 181,231,050	S2459G	probably benign	Het
Hnrnpul1	A	G	7: 25,754,359	S93P	possibly damaging	Het
Ints2	A	T	11: 86,226,748	I716N	possibly damaging	Het
Lmnb2	G	A	10: 80,905,128	Q248*	probably null	Het
Map3k7cl	A	G	16: 87,570,321	I32V	probably benign	Het
Mfsd4b4	A	T	10: 39,892,470	I255N	probably benign	Het
Myh6	A	G	14: 54,950,508	I1163T	probably benign	Het
Nphs1	A	T	7: 30,466,115	T636S	possibly damaging	Het
Ntsr1	T	A	2: 180,500,788	L124Q	probably damaging	Het
Obscn	C	T	11: 59,122,619		probably null	Het
P4ha2	G	A	11: 54,126,412		probably null	Het
Pcdha9	T	A	18: 36,999,111	V411D	probably benign	Het
Pkhd1l1	A	T	15: 44,525,988	I1380F	probably damaging	Het
Plekha1	T	C	7: 130,892,253	V106A	probably benign	Het
Plekhm1	A	T	11: 103,376,691	V818E	possibly damaging	Het
Pprc1	T	G	19: 46,065,370		probably benign	Het
Prmt9	T	C	8: 77,561,018		probably benign	Het
Rab26	T	C	17: 24,530,399	N193D	possibly damaging	Het
Rnf111	A	G	9: 70,429,580	S942P	probably damaging	Het
Scgb2b18	T	C	7: 33,173,225	T52A	probably damaging	Het
Syt3	C	T	7: 44,392,763	Q349*	probably null	Het
Tas2r107	T	C	6: 131,659,780	N102S	probably benign	Het
Tas2r126	T	A	6: 42,435,000	Y156N	possibly damaging	Het
Tcaf2	A	T	6: 42,642,778	I105N	probably benign	Het
Tet1	A	C	10: 62,879,773	M81R	probably benign	Het
Togaram2	T	C	17: 71,729,205	Y897H	probably damaging	Het
Trerf1	A	T	17: 47,314,271		noncoding transcript	Het
Ttn	G	A	2: 76,761,235	T12703I	probably damaging	Het
Unc79	A	G	12: 103,125,626	K1735E	possibly damaging	Het
Usp54	G	A	14: 20,583,351	T372I	possibly damaging	Het
Wdr24	T	C	17: 25,827,128	S476P	probably benign	Het
Wdr78	G	A	4: 103,049,589	P676S	probably benign	Het
Zbtb1	T	C	12: 76,386,275	I345T	possibly damaging	Het
Zcrb1	T	A	15: 93,395,615	I29L	probably benign	Het
Zfp341	T	A	2: 154,630,441	C315S	probably damaging	Het
Zfp623	C	A	15: 75,948,163	R323S	probably benign	Het
Zfp831	T	A	2: 174,644,092	Y187N	possibly damaging	Het

Other mutations in Celsr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Celsr1	APN	15	85931345	missense	probably benign	0.04
IGL00519:Celsr1	APN	15	86030836	missense	probably damaging	1.00
IGL00909:Celsr1	APN	15	85922235	missense	probably damaging	1.00
IGL01303:Celsr1	APN	15	86030491	missense	probably damaging	0.97
IGL01726:Celsr1	APN	15	85926190	missense	probably benign	0.35
IGL01910:Celsr1	APN	15	85929895	missense	probably benign
IGL01931:Celsr1	APN	15	85907660	missense	probably damaging	1.00
IGL01952:Celsr1	APN	15	85963223	missense	probably benign	0.35
IGL02090:Celsr1	APN	15	85907721	missense	possibly damaging	0.49
IGL02191:Celsr1	APN	15	85979004	missense	possibly damaging	0.69
IGL02372:Celsr1	APN	15	85929907	missense	probably benign	0.01
IGL02413:Celsr1	APN	15	86031226	missense	possibly damaging	0.96
IGL02478:Celsr1	APN	15	85941136	missense	possibly damaging	0.68
IGL02507:Celsr1	APN	15	85900688	utr 3 prime	probably benign
IGL02508:Celsr1	APN	15	86030617	nonsense	probably null
IGL02899:Celsr1	APN	15	86031726	missense	probably damaging	0.98
IGL02939:Celsr1	APN	15	85901472	missense	probably benign
IGL03212:Celsr1	APN	15	85930677	missense	probably benign	0.04
P0028:Celsr1	UTSW	15	85922235	missense	probably damaging	1.00
PIT4305001:Celsr1	UTSW	15	85900937	missense	possibly damaging	0.87
PIT4480001:Celsr1	UTSW	15	86032414	missense	probably damaging	0.99
R0018:Celsr1	UTSW	15	86031042	missense	possibly damaging	0.47
R0018:Celsr1	UTSW	15	86031042	missense	possibly damaging	0.47
R0038:Celsr1	UTSW	15	85929419	missense	possibly damaging	0.65
R0057:Celsr1	UTSW	15	86030762	missense	probably benign	0.02
R0060:Celsr1	UTSW	15	85922198	missense	probably damaging	0.98
R0060:Celsr1	UTSW	15	85922198	missense	probably damaging	0.98
R0279:Celsr1	UTSW	15	85902864	missense	probably benign	0.00
R0570:Celsr1	UTSW	15	85903365	missense	probably benign	0.18
R0611:Celsr1	UTSW	15	85932323	missense	possibly damaging	0.91
R0731:Celsr1	UTSW	15	85901597	missense	probably benign
R0792:Celsr1	UTSW	15	85931276	missense	probably benign	0.02
R0943:Celsr1	UTSW	15	85903288	missense	probably damaging	1.00
R0989:Celsr1	UTSW	15	86031279	missense	probably benign	0.39
R1118:Celsr1	UTSW	15	86032047	missense	probably damaging	1.00
R1237:Celsr1	UTSW	15	85903974	missense	probably benign	0.01
R1239:Celsr1	UTSW	15	85979146	missense	probably damaging	0.99
R1405:Celsr1	UTSW	15	85905434	splice site	probably null
R1405:Celsr1	UTSW	15	85905434	splice site	probably null
R1522:Celsr1	UTSW	15	85931276	missense	probably benign	0.02
R1662:Celsr1	UTSW	15	86031062	missense	probably damaging	1.00
R1673:Celsr1	UTSW	15	85932457	missense	probably benign	0.00
R1795:Celsr1	UTSW	15	86030323	missense	probably damaging	0.99
R1799:Celsr1	UTSW	15	86032685	missense	probably damaging	1.00
R1858:Celsr1	UTSW	15	86032759	missense	probably damaging	1.00
R2040:Celsr1	UTSW	15	86032887	missense	probably damaging	1.00
R2050:Celsr1	UTSW	15	86030547	missense	probably benign	0.02
R2131:Celsr1	UTSW	15	85963223	missense	probably benign	0.35
R2132:Celsr1	UTSW	15	86031967	missense	possibly damaging	0.91
R2189:Celsr1	UTSW	15	85979230	missense	possibly damaging	0.93
R2192:Celsr1	UTSW	15	85916723	missense	possibly damaging	0.93
R4213:Celsr1	UTSW	15	86031807	missense	probably damaging	1.00
R4356:Celsr1	UTSW	15	85978827	missense	probably damaging	1.00
R4414:Celsr1	UTSW	15	85963133	missense	probably benign	0.00
R4414:Celsr1	UTSW	15	85927999	missense	probably damaging	1.00
R4416:Celsr1	UTSW	15	85927999	missense	probably damaging	1.00
R4645:Celsr1	UTSW	15	85916756	missense	probably benign	0.35
R4666:Celsr1	UTSW	15	86030494	missense	probably damaging	1.00
R4687:Celsr1	UTSW	15	85932460	missense	possibly damaging	0.94
R4735:Celsr1	UTSW	15	85906029	critical splice acceptor site	probably null
R4804:Celsr1	UTSW	15	85937953	missense	possibly damaging	0.49
R4995:Celsr1	UTSW	15	85937911	missense	probably damaging	0.99
R5070:Celsr1	UTSW	15	85939134	missense	possibly damaging	0.89
R5218:Celsr1	UTSW	15	85932384	missense	probably damaging	1.00
R5280:Celsr1	UTSW	15	85930546	missense	probably benign
R5310:Celsr1	UTSW	15	85926222	missense	possibly damaging	0.88
R5388:Celsr1	UTSW	15	85925518	missense	probably damaging	0.99
R5484:Celsr1	UTSW	15	85931282	missense	probably benign	0.00
R5639:Celsr1	UTSW	15	86030767	missense	probably damaging	1.00
R5758:Celsr1	UTSW	15	85941264	missense	probably benign	0.27
R5778:Celsr1	UTSW	15	86032955	missense	probably damaging	1.00
R5893:Celsr1	UTSW	15	85904014	missense	probably benign	0.02
R5915:Celsr1	UTSW	15	85937975	missense	probably benign
R5915:Celsr1	UTSW	15	86030349	missense	probably damaging	0.96
R5932:Celsr1	UTSW	15	86032704	missense	probably damaging	1.00
R5950:Celsr1	UTSW	15	86032500	missense	probably damaging	1.00
R6050:Celsr1	UTSW	15	85930611	missense	probably benign	0.00
R6117:Celsr1	UTSW	15	85932411	missense	probably benign	0.04
R6178:Celsr1	UTSW	15	85901021	missense	probably benign	0.08
R6186:Celsr1	UTSW	15	85921193	missense	possibly damaging	0.84
R6212:Celsr1	UTSW	15	85916687	missense	probably benign	0.25
R6307:Celsr1	UTSW	15	85928330	missense	probably benign
R6320:Celsr1	UTSW	15	85900959	missense	probably benign	0.13
R6349:Celsr1	UTSW	15	86031684	missense	probably damaging	1.00
R6478:Celsr1	UTSW	15	85925518	missense	probably damaging	0.99
R6504:Celsr1	UTSW	15	85978920	missense	probably benign	0.07
R6607:Celsr1	UTSW	15	85963285	missense	probably benign
R6615:Celsr1	UTSW	15	85902114	critical splice donor site	probably null
R6661:Celsr1	UTSW	15	85918934	missense	probably damaging	1.00
R6722:Celsr1	UTSW	15	85905914	critical splice donor site	probably null
R6743:Celsr1	UTSW	15	85907598	missense	probably damaging	0.96
R6746:Celsr1	UTSW	15	86031495	missense	probably damaging	1.00
R6772:Celsr1	UTSW	15	86030782	missense	probably benign
R6838:Celsr1	UTSW	15	85939194	missense	probably benign
R6886:Celsr1	UTSW	15	86031654	missense	probably benign	0.00
R7030:Celsr1	UTSW	15	85905478	missense	probably damaging	0.99
R7060:Celsr1	UTSW	15	86032655	missense	probably benign	0.07
R7080:Celsr1	UTSW	15	85932451	missense	possibly damaging	0.87
R7325:Celsr1	UTSW	15	86033008	missense	probably damaging	0.99
R7357:Celsr1	UTSW	15	86030514	missense	probably benign	0.00
R7371:Celsr1	UTSW	15	86030674	missense	possibly damaging	0.91
R7446:Celsr1	UTSW	15	85907673	missense	possibly damaging	0.95
R7465:Celsr1	UTSW	15	86033392	missense	probably benign
R7491:Celsr1	UTSW	15	86032518	missense	possibly damaging	0.78
R7639:Celsr1	UTSW	15	85929872	missense	probably benign	0.00
R7685:Celsr1	UTSW	15	85978732	nonsense	probably null
R7741:Celsr1	UTSW	15	85979102	missense	possibly damaging	0.94
R7768:Celsr1	UTSW	15	85932409	missense	probably benign
R7974:Celsr1	UTSW	15	86031030	missense	probably damaging	1.00
R7977:Celsr1	UTSW	15	86032993	missense	probably damaging	1.00
R7987:Celsr1	UTSW	15	86032993	missense	probably damaging	1.00
R8073:Celsr1	UTSW	15	85939155	missense	probably benign	0.00
R8099:Celsr1	UTSW	15	86031600	missense	probably damaging	0.99
R8190:Celsr1	UTSW	15	85902889	missense	probably damaging	0.99
R8210:Celsr1	UTSW	15	85979235	missense	probably benign	0.00
R8289:Celsr1	UTSW	15	86033085	nonsense	probably null
R8290:Celsr1	UTSW	15	86033085	nonsense	probably null
R8292:Celsr1	UTSW	15	85907618	missense	possibly damaging	0.90
R8328:Celsr1	UTSW	15	85922244	missense	probably benign	0.00
R8330:Celsr1	UTSW	15	85932300	missense	probably damaging	0.99
R8333:Celsr1	UTSW	15	86031414	missense	possibly damaging	0.65
R8352:Celsr1	UTSW	15	86033085	nonsense	probably null
R8384:Celsr1	UTSW	15	86033085	nonsense	probably null
R8452:Celsr1	UTSW	15	86033085	nonsense	probably null
R8463:Celsr1	UTSW	15	86030214	missense	probably damaging	1.00
R8479:Celsr1	UTSW	15	86033085	nonsense	probably null
R8480:Celsr1	UTSW	15	86033085	nonsense	probably null
R8493:Celsr1	UTSW	15	85938006	missense	possibly damaging	0.67
R8498:Celsr1	UTSW	15	85939105	missense	probably benign	0.01
R8506:Celsr1	UTSW	15	86033085	nonsense	probably null
R8771:Celsr1	UTSW	15	85903974	missense	probably benign	0.01
R8891:Celsr1	UTSW	15	85937993	missense	probably benign	0.01
R8905:Celsr1	UTSW	15	85904068	intron	probably benign
R8924:Celsr1	UTSW	15	86032470	missense	possibly damaging	0.94
R8979:Celsr1	UTSW	15	85963139	missense	probably damaging	0.96
R9069:Celsr1	UTSW	15	86030571	missense	possibly damaging	0.53
R9115:Celsr1	UTSW	15	85919016	missense	probably damaging	1.00
R9194:Celsr1	UTSW	15	86033085	nonsense	probably null
R9196:Celsr1	UTSW	15	86033085	nonsense	probably null
R9198:Celsr1	UTSW	15	86033085	nonsense	probably null
R9200:Celsr1	UTSW	15	86033085	nonsense	probably null
R9201:Celsr1	UTSW	15	86033085	nonsense	probably null
R9202:Celsr1	UTSW	15	86033085	nonsense	probably null
R9203:Celsr1	UTSW	15	86033085	nonsense	probably null
R9222:Celsr1	UTSW	15	85931270	missense	possibly damaging	0.68
R9236:Celsr1	UTSW	15	86030850	missense	probably damaging	1.00
R9384:Celsr1	UTSW	15	86033085	nonsense	probably null
R9386:Celsr1	UTSW	15	85979030	missense	probably damaging	1.00
R9400:Celsr1	UTSW	15	86033085	nonsense	probably null
R9401:Celsr1	UTSW	15	86033085	nonsense	probably null
R9415:Celsr1	UTSW	15	86033085	nonsense	probably null
R9428:Celsr1	UTSW	15	85931348	missense	possibly damaging	0.64
R9435:Celsr1	UTSW	15	85922334	splice site	probably benign
R9493:Celsr1	UTSW	15	85901145	missense	probably damaging	0.98
R9495:Celsr1	UTSW	15	86033085	nonsense	probably null
R9499:Celsr1	UTSW	15	86033085	nonsense	probably null
R9607:Celsr1	UTSW	15	86031028	missense
R9673:Celsr1	UTSW	15	86033085	nonsense	probably null
Z1176:Celsr1	UTSW	15	85963100	missense	probably damaging	0.96
Z1177:Celsr1	UTSW	15	85978851	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGGTTCTCAGGCTTGCCAG -3'
(R):5'- GGCCCTCAATTTCCGTATGG -3'

Sequencing Primer
(F):5'- GAAATGTCCATGAGCACC -3'
(R):5'- CCCTCAATTTCCGTATGGTGAAGG -3'

Posted On

2017-03-31