Incidental Mutation 'R5975:Rab26'
ID 471727
Institutional Source Beutler Lab
Gene Symbol Rab26
Ensembl Gene ENSMUSG00000079657
Gene Name RAB26, member RAS oncogene family
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock # R5975 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 24527241-24534210 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 24530399 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 193 (N193D)
Ref Sequence ENSEMBL: ENSMUSP00000135775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035797] [ENSMUST00000061764] [ENSMUST00000176086] [ENSMUST00000176178] [ENSMUST00000176237] [ENSMUST00000176324] [ENSMUST00000176353] [ENSMUST00000176533] [ENSMUST00000177405] [ENSMUST00000177401] [ENSMUST00000176652] [ENSMUST00000177193] [ENSMUST00000177025] [ENSMUST00000177154] [ENSMUST00000176668]
AlphaFold Q504M8
Predicted Effect possibly damaging
Transcript: ENSMUST00000035797
AA Change: N158D

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000046089
Gene: ENSMUSG00000079657
AA Change: N158D

DomainStartEndE-ValueType
low complexity region 40 50 N/A INTRINSIC
RAB 68 232 2.84e-101 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000061764
SMART Domains Protein: ENSMUSP00000055970
Gene: ENSMUSG00000079657

DomainStartEndE-ValueType
low complexity region 40 50 N/A INTRINSIC
Pfam:Arf 59 145 1.1e-8 PFAM
Pfam:Ras 69 145 6.6e-27 PFAM
Pfam:Roc 69 157 4.7e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082834
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176025
Predicted Effect probably benign
Transcript: ENSMUST00000176086
SMART Domains Protein: ENSMUSP00000135845
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 103 132 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176092
Predicted Effect probably benign
Transcript: ENSMUST00000176178
SMART Domains Protein: ENSMUSP00000134808
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176215
Predicted Effect probably benign
Transcript: ENSMUST00000176237
SMART Domains Protein: ENSMUSP00000134946
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
RING 91 124 4.73e-6 SMART
Pfam:zf-TRAF 182 238 8.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176324
Predicted Effect probably benign
Transcript: ENSMUST00000176353
SMART Domains Protein: ENSMUSP00000135267
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
RING 92 125 4.73e-6 SMART
coiled coil region 264 332 N/A INTRINSIC
WD40 344 383 8.35e-11 SMART
WD40 387 424 8.42e-7 SMART
WD40 427 463 2.09e-2 SMART
WD40 468 504 1.92e0 SMART
WD40 507 544 5.15e-2 SMART
WD40 547 588 1.78e-5 SMART
WD40 591 628 1.63e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176361
Predicted Effect possibly damaging
Transcript: ENSMUST00000176533
AA Change: N193D

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000135775
Gene: ENSMUSG00000079657
AA Change: N193D

DomainStartEndE-ValueType
low complexity region 75 85 N/A INTRINSIC
RAB 103 267 2.84e-101 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177441
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176921
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177139
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176434
Predicted Effect probably benign
Transcript: ENSMUST00000177405
SMART Domains Protein: ENSMUSP00000135127
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177401
Predicted Effect probably benign
Transcript: ENSMUST00000176652
SMART Domains Protein: ENSMUSP00000134759
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 90 104 N/A INTRINSIC
low complexity region 109 117 N/A INTRINSIC
RING 130 163 4.73e-6 SMART
coiled coil region 304 372 N/A INTRINSIC
WD40 384 423 8.35e-11 SMART
WD40 427 464 8.42e-7 SMART
WD40 467 503 2.09e-2 SMART
WD40 508 544 1.92e0 SMART
WD40 547 584 5.15e-2 SMART
WD40 587 628 1.78e-5 SMART
WD40 631 668 1.63e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177193
SMART Domains Protein: ENSMUSP00000135288
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 90 104 N/A INTRINSIC
low complexity region 109 117 N/A INTRINSIC
RING 130 163 4.73e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177025
Predicted Effect probably benign
Transcript: ENSMUST00000177154
SMART Domains Protein: ENSMUSP00000135874
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 91 105 N/A INTRINSIC
low complexity region 110 118 N/A INTRINSIC
RING 131 164 4.73e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176668
SMART Domains Protein: ENSMUSP00000135586
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
Meta Mutation Damage Score 0.6808 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 98% (80/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the RAB protein family, including RAB26, are important regulators of vesicular fusion and trafficking. The RAB family of small G proteins regulates intercellular vesicle trafficking, including exocytosis, endocytosis, and recycling (summary by Seki et al., 2000 [PubMed 11043516]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 36,969,221 T2233I possibly damaging Het
9430038I01Rik T C 7: 137,387,292 probably benign Het
Abhd14a A T 9: 106,443,951 probably null Het
Actn2 T C 13: 12,340,497 N2D probably benign Het
Adcy9 T C 16: 4,311,567 E722G probably damaging Het
Alox12 C A 11: 70,242,783 V572L possibly damaging Het
Ankrd11 T C 8: 122,889,749 I2434V possibly damaging Het
Anks1 T A 17: 27,991,447 probably null Het
Bpifa3 T A 2: 154,136,321 S148T probably damaging Het
Bptf C T 11: 107,035,864 probably benign Het
Cabin1 A T 10: 75,657,839 L1655H probably damaging Het
Ccdc13 G T 9: 121,827,235 Q171K probably benign Het
Ccdc33 T A 9: 58,117,478 Q155L possibly damaging Het
Cckbr G A 7: 105,470,619 G280E probably benign Het
Cdk11b G A 4: 155,648,240 probably benign Het
Celsr1 G T 15: 85,919,038 probably null Het
Cenpj A T 14: 56,564,066 I150N possibly damaging Het
Cep135 C A 5: 76,640,890 A1110E possibly damaging Het
Chit1 C A 1: 134,146,626 H224N probably damaging Het
Cul5 T C 9: 53,622,793 R680G probably damaging Het
Dhx58 C A 11: 100,702,209 R224L probably damaging Het
Dlx1 C A 2: 71,531,009 N122K probably damaging Het
Dnah5 A C 15: 28,234,282 D279A probably damaging Het
Enpp3 A G 10: 24,774,842 W799R probably benign Het
Ercc5 A G 1: 44,173,406 T675A probably benign Het
Farsa T A 8: 84,864,432 probably null Het
Fbxw15 A T 9: 109,555,252 V397D probably damaging Het
Fcrl5 G A 3: 87,442,103 V62I probably benign Het
Gart A G 16: 91,624,336 S815P probably damaging Het
Glrx5 A G 12: 105,040,323 N111S possibly damaging Het
Gm10845 A G 14: 79,863,174 noncoding transcript Het
Gm11639 A G 11: 104,687,549 probably benign Het
Gm8882 A G 6: 132,362,073 S61P unknown Het
Gm9925 T A 18: 74,065,516 probably benign Het
Gsdme T C 6: 50,227,359 N206S probably benign Het
Helz2 T C 2: 181,231,050 S2459G probably benign Het
Hnrnpul1 A G 7: 25,754,359 S93P possibly damaging Het
Ints2 A T 11: 86,226,748 I716N possibly damaging Het
Lmnb2 G A 10: 80,905,128 Q248* probably null Het
Map3k7cl A G 16: 87,570,321 I32V probably benign Het
Mfsd4b4 A T 10: 39,892,470 I255N probably benign Het
Myh6 A G 14: 54,950,508 I1163T probably benign Het
Nphs1 A T 7: 30,466,115 T636S possibly damaging Het
Ntsr1 T A 2: 180,500,788 L124Q probably damaging Het
Obscn C T 11: 59,122,619 probably null Het
P4ha2 G A 11: 54,126,412 probably null Het
Pcdha9 T A 18: 36,999,111 V411D probably benign Het
Pkhd1l1 A T 15: 44,525,988 I1380F probably damaging Het
Plekha1 T C 7: 130,892,253 V106A probably benign Het
Plekhm1 A T 11: 103,376,691 V818E possibly damaging Het
Pprc1 T G 19: 46,065,370 probably benign Het
Prmt9 T C 8: 77,561,018 probably benign Het
Rnf111 A G 9: 70,429,580 S942P probably damaging Het
Scgb2b18 T C 7: 33,173,225 T52A probably damaging Het
Syt3 C T 7: 44,392,763 Q349* probably null Het
Tas2r107 T C 6: 131,659,780 N102S probably benign Het
Tas2r126 T A 6: 42,435,000 Y156N possibly damaging Het
Tcaf2 A T 6: 42,642,778 I105N probably benign Het
Tet1 A C 10: 62,879,773 M81R probably benign Het
Togaram2 T C 17: 71,729,205 Y897H probably damaging Het
Trerf1 A T 17: 47,314,271 noncoding transcript Het
Ttn G A 2: 76,761,235 T12703I probably damaging Het
Unc79 A G 12: 103,125,626 K1735E possibly damaging Het
Usp54 G A 14: 20,583,351 T372I possibly damaging Het
Wdr24 T C 17: 25,827,128 S476P probably benign Het
Wdr78 G A 4: 103,049,589 P676S probably benign Het
Zbtb1 T C 12: 76,386,275 I345T possibly damaging Het
Zcrb1 T A 15: 93,395,615 I29L probably benign Het
Zfp341 T A 2: 154,630,441 C315S probably damaging Het
Zfp623 C A 15: 75,948,163 R323S probably benign Het
Zfp831 T A 2: 174,644,092 Y187N possibly damaging Het
Other mutations in Rab26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02636:Rab26 APN 17 24533559 missense probably benign 0.01
R0131:Rab26 UTSW 17 24530785 critical splice donor site probably null
R0131:Rab26 UTSW 17 24530785 critical splice donor site probably null
R0132:Rab26 UTSW 17 24530785 critical splice donor site probably null
R0377:Rab26 UTSW 17 24530045 unclassified probably benign
R0567:Rab26 UTSW 17 24529582 missense probably damaging 0.99
R0681:Rab26 UTSW 17 24527966 unclassified probably benign
R5103:Rab26 UTSW 17 24534097 unclassified probably benign
R5226:Rab26 UTSW 17 24534133 unclassified probably benign
R6307:Rab26 UTSW 17 24530098 missense probably damaging 1.00
R6601:Rab26 UTSW 17 24529621 nonsense probably null
R6897:Rab26 UTSW 17 24529792 missense probably damaging 1.00
R7122:Rab26 UTSW 17 24530678 missense probably damaging 1.00
R7155:Rab26 UTSW 17 24532289 missense probably damaging 0.99
R8708:Rab26 UTSW 17 24529798 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTGCCACACCTGATTGAG -3'
(R):5'- CAAGTAGGCACACTTATGGGACAG -3'

Sequencing Primer
(F):5'- CTAGAAGCCCTTATTTATCCAGGTGG -3'
(R):5'- CAGCAGGTGAGGGTGATGC -3'
Posted On 2017-03-31