Incidental Mutation 'R5975:Anks1'
ID471729
Institutional Source Beutler Lab
Gene Symbol Anks1
Ensembl Gene ENSMUSG00000024219
Gene Nameankyrin repeat and SAM domain containing 1
SynonymsOdin
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5975 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location27909340-28062600 bp(+) (GRCm38)
Type of Mutationintron (47 bp from exon)
DNA Base Change (assembly) T to A at 27991447 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025058] [ENSMUST00000088027] [ENSMUST00000114842]
Predicted Effect probably null
Transcript: ENSMUST00000025058
SMART Domains Protein: ENSMUSP00000025058
Gene: ENSMUSG00000024219

DomainStartEndE-ValueType
low complexity region 22 62 N/A INTRINSIC
ANK 75 104 1.08e-5 SMART
ANK 108 137 7.42e-4 SMART
ANK 165 194 1.88e-5 SMART
ANK 198 227 1.93e-2 SMART
ANK 231 260 1.64e-5 SMART
ANK 263 292 7.71e-2 SMART
low complexity region 419 439 N/A INTRINSIC
low complexity region 633 647 N/A INTRINSIC
SAM 709 778 3.2e-16 SMART
SAM 783 851 4.33e-13 SMART
Blast:PTB 861 919 2e-22 BLAST
PTB 953 1087 3.17e-43 SMART
low complexity region 1126 1135 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000088027
SMART Domains Protein: ENSMUSP00000085344
Gene: ENSMUSG00000024219

DomainStartEndE-ValueType
low complexity region 22 62 N/A INTRINSIC
ANK 75 104 1.08e-5 SMART
ANK 108 137 7.42e-4 SMART
ANK 144 173 1.88e-5 SMART
ANK 177 206 1.93e-2 SMART
ANK 210 239 1.64e-5 SMART
ANK 242 271 7.71e-2 SMART
low complexity region 398 418 N/A INTRINSIC
low complexity region 612 626 N/A INTRINSIC
SAM 688 757 3.2e-16 SMART
SAM 762 830 4.33e-13 SMART
Blast:PTB 840 898 2e-22 BLAST
PTB 932 1066 3.17e-43 SMART
low complexity region 1105 1114 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114842
SMART Domains Protein: ENSMUSP00000110491
Gene: ENSMUSG00000024219

DomainStartEndE-ValueType
low complexity region 22 62 N/A INTRINSIC
ANK 75 104 1.08e-5 SMART
ANK 108 137 7.42e-4 SMART
ANK 165 194 1.88e-5 SMART
ANK 198 227 1.93e-2 SMART
ANK 231 260 1.64e-5 SMART
ANK 263 292 7.71e-2 SMART
low complexity region 419 439 N/A INTRINSIC
low complexity region 633 647 N/A INTRINSIC
SAM 709 778 3.2e-16 SMART
SAM 783 851 4.33e-13 SMART
Blast:PTB 861 919 2e-22 BLAST
PTB 953 1087 3.17e-43 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156965
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 98% (80/82)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 36,969,221 T2233I possibly damaging Het
9430038I01Rik T C 7: 137,387,292 probably benign Het
Abhd14a A T 9: 106,443,951 probably null Het
Actn2 T C 13: 12,340,497 N2D probably benign Het
Adcy9 T C 16: 4,311,567 E722G probably damaging Het
Alox12 C A 11: 70,242,783 V572L possibly damaging Het
Ankrd11 T C 8: 122,889,749 I2434V possibly damaging Het
Bpifa3 T A 2: 154,136,321 S148T probably damaging Het
Bptf C T 11: 107,035,864 probably benign Het
Cabin1 A T 10: 75,657,839 L1655H probably damaging Het
Ccdc13 G T 9: 121,827,235 Q171K probably benign Het
Ccdc33 T A 9: 58,117,478 Q155L possibly damaging Het
Cckbr G A 7: 105,470,619 G280E probably benign Het
Cdk11b G A 4: 155,648,240 probably benign Het
Celsr1 G T 15: 85,919,038 probably null Het
Cenpj A T 14: 56,564,066 I150N possibly damaging Het
Cep135 C A 5: 76,640,890 A1110E possibly damaging Het
Chit1 C A 1: 134,146,626 H224N probably damaging Het
Cul5 T C 9: 53,622,793 R680G probably damaging Het
Dhx58 C A 11: 100,702,209 R224L probably damaging Het
Dlx1 C A 2: 71,531,009 N122K probably damaging Het
Dnah5 A C 15: 28,234,282 D279A probably damaging Het
Enpp3 A G 10: 24,774,842 W799R probably benign Het
Ercc5 A G 1: 44,173,406 T675A probably benign Het
Farsa T A 8: 84,864,432 probably null Het
Fbxw15 A T 9: 109,555,252 V397D probably damaging Het
Fcrl5 G A 3: 87,442,103 V62I probably benign Het
Gart A G 16: 91,624,336 S815P probably damaging Het
Glrx5 A G 12: 105,040,323 N111S possibly damaging Het
Gm10845 A G 14: 79,863,174 noncoding transcript Het
Gm11639 A G 11: 104,687,549 probably benign Het
Gm8882 A G 6: 132,362,073 S61P unknown Het
Gm9925 T A 18: 74,065,516 probably benign Het
Gsdme T C 6: 50,227,359 N206S probably benign Het
Helz2 T C 2: 181,231,050 S2459G probably benign Het
Hnrnpul1 A G 7: 25,754,359 S93P possibly damaging Het
Ints2 A T 11: 86,226,748 I716N possibly damaging Het
Lmnb2 G A 10: 80,905,128 Q248* probably null Het
Map3k7cl A G 16: 87,570,321 I32V probably benign Het
Mfsd4b4 A T 10: 39,892,470 I255N probably benign Het
Myh6 A G 14: 54,950,508 I1163T probably benign Het
Nphs1 A T 7: 30,466,115 T636S possibly damaging Het
Ntsr1 T A 2: 180,500,788 L124Q probably damaging Het
Obscn C T 11: 59,122,619 probably null Het
P4ha2 G A 11: 54,126,412 probably null Het
Pcdha9 T A 18: 36,999,111 V411D probably benign Het
Pkhd1l1 A T 15: 44,525,988 I1380F probably damaging Het
Plekha1 T C 7: 130,892,253 V106A probably benign Het
Plekhm1 A T 11: 103,376,691 V818E possibly damaging Het
Pprc1 T G 19: 46,065,370 probably benign Het
Prmt9 T C 8: 77,561,018 probably benign Het
Rab26 T C 17: 24,530,399 N193D possibly damaging Het
Rnf111 A G 9: 70,429,580 S942P probably damaging Het
Scgb2b18 T C 7: 33,173,225 T52A probably damaging Het
Syt3 C T 7: 44,392,763 Q349* probably null Het
Tas2r107 T C 6: 131,659,780 N102S probably benign Het
Tas2r126 T A 6: 42,435,000 Y156N possibly damaging Het
Tcaf2 A T 6: 42,642,778 I105N probably benign Het
Tet1 A C 10: 62,879,773 M81R probably benign Het
Togaram2 T C 17: 71,729,205 Y897H probably damaging Het
Trerf1 A T 17: 47,314,271 noncoding transcript Het
Ttn G A 2: 76,761,235 T12703I probably damaging Het
Unc79 A G 12: 103,125,626 K1735E possibly damaging Het
Usp54 G A 14: 20,583,351 T372I possibly damaging Het
Wdr24 T C 17: 25,827,128 S476P probably benign Het
Wdr78 G A 4: 103,049,589 P676S probably benign Het
Zbtb1 T C 12: 76,386,275 I345T possibly damaging Het
Zcrb1 T A 15: 93,395,615 I29L probably benign Het
Zfp341 T A 2: 154,630,441 C315S probably damaging Het
Zfp623 C A 15: 75,948,163 R323S probably benign Het
Zfp831 T A 2: 174,644,092 Y187N possibly damaging Het
Other mutations in Anks1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Anks1 APN 17 28058416 missense possibly damaging 0.94
IGL00816:Anks1 APN 17 28059393 critical splice donor site probably null
IGL00940:Anks1 APN 17 28057354 missense probably damaging 1.00
IGL01306:Anks1 APN 17 27986253 missense probably damaging 1.00
IGL01485:Anks1 APN 17 28051584 missense probably damaging 1.00
IGL02059:Anks1 APN 17 28008046 missense possibly damaging 0.64
IGL02220:Anks1 APN 17 28054707 missense probably damaging 0.98
IGL02955:Anks1 APN 17 28054317 missense probably damaging 1.00
IGL03071:Anks1 APN 17 28008199 missense probably benign 0.37
ANU23:Anks1 UTSW 17 27986253 missense probably damaging 1.00
R0389:Anks1 UTSW 17 27995952 missense possibly damaging 0.68
R1221:Anks1 UTSW 17 28050642 missense possibly damaging 0.62
R1523:Anks1 UTSW 17 28051655 splice site probably null
R1639:Anks1 UTSW 17 28058306 missense probably damaging 1.00
R1816:Anks1 UTSW 17 27986573 missense probably damaging 1.00
R1981:Anks1 UTSW 17 27985121 missense probably damaging 1.00
R1982:Anks1 UTSW 17 27985121 missense probably damaging 1.00
R2041:Anks1 UTSW 17 28008414 missense probably damaging 1.00
R2099:Anks1 UTSW 17 27978491 critical splice donor site probably null
R2897:Anks1 UTSW 17 27985363 critical splice donor site probably null
R2965:Anks1 UTSW 17 28053905 missense probably benign
R3624:Anks1 UTSW 17 27986288 missense probably damaging 0.99
R4671:Anks1 UTSW 17 28051578 missense probably benign 0.45
R4786:Anks1 UTSW 17 28052730 missense possibly damaging 0.93
R4871:Anks1 UTSW 17 27991377 missense probably benign 0.00
R4936:Anks1 UTSW 17 27988805 missense probably damaging 1.00
R5175:Anks1 UTSW 17 28042588 missense probably damaging 1.00
R5908:Anks1 UTSW 17 27996019 missense probably damaging 1.00
R6226:Anks1 UTSW 17 28057330 missense probably benign 0.01
R6306:Anks1 UTSW 17 28050639 missense probably damaging 1.00
R6332:Anks1 UTSW 17 28052735 missense probably benign
R6891:Anks1 UTSW 17 28057424 missense probably damaging 1.00
R6995:Anks1 UTSW 17 28054299 missense probably damaging 1.00
R7465:Anks1 UTSW 17 28054323 missense possibly damaging 0.48
R7502:Anks1 UTSW 17 28008140 missense possibly damaging 0.48
R7749:Anks1 UTSW 17 28038141 missense probably damaging 0.96
R8005:Anks1 UTSW 17 28059367 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTCCCTGTAGCCATGAAC -3'
(R):5'- CACATGGCTCTGGGTTTAATCC -3'

Sequencing Primer
(F):5'- AGTCTGGTCTACACAGCAAGTTC -3'
(R):5'- CTAGAGAGATGGTTCAGCTGGACTC -3'
Posted On2017-03-31