Mutagenetix > Incidental Mutations

Incidental Mutation 'R5975:Anks1'

471729

Institutional Source

Beutler Lab

Gene Symbol

Anks1

Ensembl Gene

ENSMUSG00000024219

Gene Name

ankyrin repeat and SAM domain containing 1

Synonyms

Odin

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5975 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

27909340-28062600 bp(+) (GRCm38)

Type of Mutation

intron (47 bp from exon)

DNA Base Change (assembly)

T to A at 27991447 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000110491 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025058] [ENSMUST00000088027] [ENSMUST00000114842]

Predicted Effect

probably null
Transcript: ENSMUST00000025058

SMART Domains

Protein: ENSMUSP00000025058
Gene: ENSMUSG00000024219

Domain	Start	End	E-Value	Type
low complexity region	22	62	N/A	INTRINSIC
ANK	75	104	1.08e-5	SMART
ANK	108	137	7.42e-4	SMART
ANK	165	194	1.88e-5	SMART
ANK	198	227	1.93e-2	SMART
ANK	231	260	1.64e-5	SMART
ANK	263	292	7.71e-2	SMART
low complexity region	419	439	N/A	INTRINSIC
low complexity region	633	647	N/A	INTRINSIC
SAM	709	778	3.2e-16	SMART
SAM	783	851	4.33e-13	SMART
Blast:PTB	861	919	2e-22	BLAST
PTB	953	1087	3.17e-43	SMART
low complexity region	1126	1135	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000088027

SMART Domains

Protein: ENSMUSP00000085344
Gene: ENSMUSG00000024219

Domain	Start	End	E-Value	Type
low complexity region	22	62	N/A	INTRINSIC
ANK	75	104	1.08e-5	SMART
ANK	108	137	7.42e-4	SMART
ANK	144	173	1.88e-5	SMART
ANK	177	206	1.93e-2	SMART
ANK	210	239	1.64e-5	SMART
ANK	242	271	7.71e-2	SMART
low complexity region	398	418	N/A	INTRINSIC
low complexity region	612	626	N/A	INTRINSIC
SAM	688	757	3.2e-16	SMART
SAM	762	830	4.33e-13	SMART
Blast:PTB	840	898	2e-22	BLAST
PTB	932	1066	3.17e-43	SMART
low complexity region	1105	1114	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000114842

SMART Domains

Protein: ENSMUSP00000110491
Gene: ENSMUSG00000024219

Domain	Start	End	E-Value	Type
low complexity region	22	62	N/A	INTRINSIC
ANK	75	104	1.08e-5	SMART
ANK	108	137	7.42e-4	SMART
ANK	165	194	1.88e-5	SMART
ANK	198	227	1.93e-2	SMART
ANK	231	260	1.64e-5	SMART
ANK	263	292	7.71e-2	SMART
low complexity region	419	439	N/A	INTRINSIC
low complexity region	633	647	N/A	INTRINSIC
SAM	709	778	3.2e-16	SMART
SAM	783	851	4.33e-13	SMART
Blast:PTB	861	919	2e-22	BLAST
PTB	953	1087	3.17e-43	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156965

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.8%
20x: 93.3%

Validation Efficiency

98% (80/82)

MGI Phenotype

PHENOTYPE: Mice homozygous for a gene trapped allele exhibit a normal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	C	T	3: 36,969,221	T2233I	possibly damaging	Het
9430038I01Rik	T	C	7: 137,387,292		probably benign	Het
Abhd14a	A	T	9: 106,443,951		probably null	Het
Actn2	T	C	13: 12,340,497	N2D	probably benign	Het
Adcy9	T	C	16: 4,311,567	E722G	probably damaging	Het
Alox12	C	A	11: 70,242,783	V572L	possibly damaging	Het
Ankrd11	T	C	8: 122,889,749	I2434V	possibly damaging	Het
Bpifa3	T	A	2: 154,136,321	S148T	probably damaging	Het
Bptf	C	T	11: 107,035,864		probably benign	Het
Cabin1	A	T	10: 75,657,839	L1655H	probably damaging	Het
Ccdc13	G	T	9: 121,827,235	Q171K	probably benign	Het
Ccdc33	T	A	9: 58,117,478	Q155L	possibly damaging	Het
Cckbr	G	A	7: 105,470,619	G280E	probably benign	Het
Cdk11b	G	A	4: 155,648,240		probably benign	Het
Celsr1	G	T	15: 85,919,038		probably null	Het
Cenpj	A	T	14: 56,564,066	I150N	possibly damaging	Het
Cep135	C	A	5: 76,640,890	A1110E	possibly damaging	Het
Chit1	C	A	1: 134,146,626	H224N	probably damaging	Het
Cul5	T	C	9: 53,622,793	R680G	probably damaging	Het
Dhx58	C	A	11: 100,702,209	R224L	probably damaging	Het
Dlx1	C	A	2: 71,531,009	N122K	probably damaging	Het
Dnah5	A	C	15: 28,234,282	D279A	probably damaging	Het
Enpp3	A	G	10: 24,774,842	W799R	probably benign	Het
Ercc5	A	G	1: 44,173,406	T675A	probably benign	Het
Farsa	T	A	8: 84,864,432		probably null	Het
Fbxw15	A	T	9: 109,555,252	V397D	probably damaging	Het
Fcrl5	G	A	3: 87,442,103	V62I	probably benign	Het
Gart	A	G	16: 91,624,336	S815P	probably damaging	Het
Glrx5	A	G	12: 105,040,323	N111S	possibly damaging	Het
Gm10845	A	G	14: 79,863,174		noncoding transcript	Het
Gm11639	A	G	11: 104,687,549		probably benign	Het
Gm8882	A	G	6: 132,362,073	S61P	unknown	Het
Gm9925	T	A	18: 74,065,516		probably benign	Het
Gsdme	T	C	6: 50,227,359	N206S	probably benign	Het
Helz2	T	C	2: 181,231,050	S2459G	probably benign	Het
Hnrnpul1	A	G	7: 25,754,359	S93P	possibly damaging	Het
Ints2	A	T	11: 86,226,748	I716N	possibly damaging	Het
Lmnb2	G	A	10: 80,905,128	Q248*	probably null	Het
Map3k7cl	A	G	16: 87,570,321	I32V	probably benign	Het
Mfsd4b4	A	T	10: 39,892,470	I255N	probably benign	Het
Myh6	A	G	14: 54,950,508	I1163T	probably benign	Het
Nphs1	A	T	7: 30,466,115	T636S	possibly damaging	Het
Ntsr1	T	A	2: 180,500,788	L124Q	probably damaging	Het
Obscn	C	T	11: 59,122,619		probably null	Het
P4ha2	G	A	11: 54,126,412		probably null	Het
Pcdha9	T	A	18: 36,999,111	V411D	probably benign	Het
Pkhd1l1	A	T	15: 44,525,988	I1380F	probably damaging	Het
Plekha1	T	C	7: 130,892,253	V106A	probably benign	Het
Plekhm1	A	T	11: 103,376,691	V818E	possibly damaging	Het
Pprc1	T	G	19: 46,065,370		probably benign	Het
Prmt9	T	C	8: 77,561,018		probably benign	Het
Rab26	T	C	17: 24,530,399	N193D	possibly damaging	Het
Rnf111	A	G	9: 70,429,580	S942P	probably damaging	Het
Scgb2b18	T	C	7: 33,173,225	T52A	probably damaging	Het
Syt3	C	T	7: 44,392,763	Q349*	probably null	Het
Tas2r107	T	C	6: 131,659,780	N102S	probably benign	Het
Tas2r126	T	A	6: 42,435,000	Y156N	possibly damaging	Het
Tcaf2	A	T	6: 42,642,778	I105N	probably benign	Het
Tet1	A	C	10: 62,879,773	M81R	probably benign	Het
Togaram2	T	C	17: 71,729,205	Y897H	probably damaging	Het
Trerf1	A	T	17: 47,314,271		noncoding transcript	Het
Ttn	G	A	2: 76,761,235	T12703I	probably damaging	Het
Unc79	A	G	12: 103,125,626	K1735E	possibly damaging	Het
Usp54	G	A	14: 20,583,351	T372I	possibly damaging	Het
Wdr24	T	C	17: 25,827,128	S476P	probably benign	Het
Wdr78	G	A	4: 103,049,589	P676S	probably benign	Het
Zbtb1	T	C	12: 76,386,275	I345T	possibly damaging	Het
Zcrb1	T	A	15: 93,395,615	I29L	probably benign	Het
Zfp341	T	A	2: 154,630,441	C315S	probably damaging	Het
Zfp623	C	A	15: 75,948,163	R323S	probably benign	Het
Zfp831	T	A	2: 174,644,092	Y187N	possibly damaging	Het

Other mutations in Anks1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00471:Anks1	APN	17	28058416	missense	possibly damaging	0.94
IGL00816:Anks1	APN	17	28059393	critical splice donor site	probably null
IGL00940:Anks1	APN	17	28057354	missense	probably damaging	1.00
IGL01306:Anks1	APN	17	27986253	missense	probably damaging	1.00
IGL01485:Anks1	APN	17	28051584	missense	probably damaging	1.00
IGL02059:Anks1	APN	17	28008046	missense	possibly damaging	0.64
IGL02220:Anks1	APN	17	28054707	missense	probably damaging	0.98
IGL02955:Anks1	APN	17	28054317	missense	probably damaging	1.00
IGL03071:Anks1	APN	17	28008199	missense	probably benign	0.37
ANU23:Anks1	UTSW	17	27986253	missense	probably damaging	1.00
R0389:Anks1	UTSW	17	27995952	missense	possibly damaging	0.68
R1221:Anks1	UTSW	17	28050642	missense	possibly damaging	0.62
R1523:Anks1	UTSW	17	28051655	splice site	probably null
R1639:Anks1	UTSW	17	28058306	missense	probably damaging	1.00
R1816:Anks1	UTSW	17	27986573	missense	probably damaging	1.00
R1981:Anks1	UTSW	17	27985121	missense	probably damaging	1.00
R1982:Anks1	UTSW	17	27985121	missense	probably damaging	1.00
R2041:Anks1	UTSW	17	28008414	missense	probably damaging	1.00
R2099:Anks1	UTSW	17	27978491	critical splice donor site	probably null
R2897:Anks1	UTSW	17	27985363	critical splice donor site	probably null
R2965:Anks1	UTSW	17	28053905	missense	probably benign
R3624:Anks1	UTSW	17	27986288	missense	probably damaging	0.99
R4671:Anks1	UTSW	17	28051578	missense	probably benign	0.45
R4786:Anks1	UTSW	17	28052730	missense	possibly damaging	0.93
R4871:Anks1	UTSW	17	27991377	missense	probably benign	0.00
R4936:Anks1	UTSW	17	27988805	missense	probably damaging	1.00
R5175:Anks1	UTSW	17	28042588	missense	probably damaging	1.00
R5908:Anks1	UTSW	17	27996019	missense	probably damaging	1.00
R6226:Anks1	UTSW	17	28057330	missense	probably benign	0.01
R6306:Anks1	UTSW	17	28050639	missense	probably damaging	1.00
R6332:Anks1	UTSW	17	28052735	missense	probably benign
R6891:Anks1	UTSW	17	28057424	missense	probably damaging	1.00
R6995:Anks1	UTSW	17	28054299	missense	probably damaging	1.00
R7465:Anks1	UTSW	17	28054323	missense	possibly damaging	0.48
R7502:Anks1	UTSW	17	28008140	missense	possibly damaging	0.48
R7749:Anks1	UTSW	17	28038141	missense	probably damaging	0.96
R8005:Anks1	UTSW	17	28059367	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTTCCCTGTAGCCATGAAC -3'
(R):5'- CACATGGCTCTGGGTTTAATCC -3'

Sequencing Primer
(F):5'- AGTCTGGTCTACACAGCAAGTTC -3'
(R):5'- CTAGAGAGATGGTTCAGCTGGACTC -3'

Posted On

2017-03-31