Incidental Mutation 'R5975:Togaram2'
ID 471731
Institutional Source Beutler Lab
Gene Symbol Togaram2
Ensembl Gene ENSMUSG00000045761
Gene Name TOG array regulator of axonemal microtubules 2
Synonyms Fam179a, 4632412N22Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.075) question?
Stock # R5975 (G1)
Quality Score 214
Status Validated
Chromosome 17
Chromosomal Location 71980256-72036664 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 72036200 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 897 (Y897H)
Ref Sequence ENSEMBL: ENSMUSP00000122691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097284] [ENSMUST00000144479] [ENSMUST00000153445]
AlphaFold Q3TYG6
Predicted Effect probably damaging
Transcript: ENSMUST00000097284
AA Change: Y897H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000094886
Gene: ENSMUSG00000045761
AA Change: Y897H

DomainStartEndE-ValueType
low complexity region 49 60 N/A INTRINSIC
low complexity region 94 105 N/A INTRINSIC
low complexity region 467 474 N/A INTRINSIC
Pfam:CLASP_N 492 705 2.3e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129072
Predicted Effect probably damaging
Transcript: ENSMUST00000144479
AA Change: Y917H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114359
Gene: ENSMUSG00000045761
AA Change: Y917H

DomainStartEndE-ValueType
low complexity region 50 61 N/A INTRINSIC
low complexity region 95 106 N/A INTRINSIC
low complexity region 468 475 N/A INTRINSIC
Pfam:CLASP_N 493 706 2.4e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000153445
AA Change: Y897H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122691
Gene: ENSMUSG00000045761
AA Change: Y897H

DomainStartEndE-ValueType
low complexity region 49 60 N/A INTRINSIC
low complexity region 94 105 N/A INTRINSIC
low complexity region 467 474 N/A INTRINSIC
Pfam:CLASP_N 492 705 2.3e-21 PFAM
Meta Mutation Damage Score 0.1681 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 98% (80/82)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430038I01Rik T C 7: 136,989,021 (GRCm39) probably benign Het
Abhd14a A T 9: 106,321,150 (GRCm39) probably null Het
Actn2 T C 13: 12,355,378 (GRCm39) N2D probably benign Het
Adcy9 T C 16: 4,129,431 (GRCm39) E722G probably damaging Het
Alox12 C A 11: 70,133,609 (GRCm39) V572L possibly damaging Het
Ankrd11 T C 8: 123,616,488 (GRCm39) I2434V possibly damaging Het
Anks1 T A 17: 28,210,421 (GRCm39) probably null Het
Bltp1 C T 3: 37,023,370 (GRCm39) T2233I possibly damaging Het
Bpifa3 T A 2: 153,978,241 (GRCm39) S148T probably damaging Het
Bptf C T 11: 106,926,690 (GRCm39) probably benign Het
Cabin1 A T 10: 75,493,673 (GRCm39) L1655H probably damaging Het
Ccdc13 G T 9: 121,656,301 (GRCm39) Q171K probably benign Het
Ccdc33 T A 9: 58,024,761 (GRCm39) Q155L possibly damaging Het
Cckbr G A 7: 105,119,826 (GRCm39) G280E probably benign Het
Cdk11b G A 4: 155,732,697 (GRCm39) probably benign Het
Celsr1 G T 15: 85,803,239 (GRCm39) probably null Het
Cenpj A T 14: 56,801,523 (GRCm39) I150N possibly damaging Het
Cep135 C A 5: 76,788,737 (GRCm39) A1110E possibly damaging Het
Chit1 C A 1: 134,074,364 (GRCm39) H224N probably damaging Het
Cul5 T C 9: 53,534,093 (GRCm39) R680G probably damaging Het
Dhx58 C A 11: 100,593,035 (GRCm39) R224L probably damaging Het
Dlx1 C A 2: 71,361,353 (GRCm39) N122K probably damaging Het
Dnah5 A C 15: 28,234,428 (GRCm39) D279A probably damaging Het
Dnai4 G A 4: 102,906,786 (GRCm39) P676S probably benign Het
Efcab3 A G 11: 104,578,375 (GRCm39) probably benign Het
Enpp3 A G 10: 24,650,740 (GRCm39) W799R probably benign Het
Ercc5 A G 1: 44,212,566 (GRCm39) T675A probably benign Het
Farsa T A 8: 85,591,061 (GRCm39) probably null Het
Fbxw15 A T 9: 109,384,320 (GRCm39) V397D probably damaging Het
Fcrl5 G A 3: 87,349,410 (GRCm39) V62I probably benign Het
Gart A G 16: 91,421,224 (GRCm39) S815P probably damaging Het
Glrx5 A G 12: 105,006,582 (GRCm39) N111S possibly damaging Het
Gm10845 A G 14: 80,100,614 (GRCm39) noncoding transcript Het
Gm9925 T A 18: 74,198,587 (GRCm39) probably benign Het
Gsdme T C 6: 50,204,339 (GRCm39) N206S probably benign Het
Helz2 T C 2: 180,872,843 (GRCm39) S2459G probably benign Het
Hnrnpul1 A G 7: 25,453,784 (GRCm39) S93P possibly damaging Het
Ints2 A T 11: 86,117,574 (GRCm39) I716N possibly damaging Het
Lmnb2 G A 10: 80,740,962 (GRCm39) Q248* probably null Het
Map3k7cl A G 16: 87,367,209 (GRCm39) I32V probably benign Het
Mfsd4b4 A T 10: 39,768,466 (GRCm39) I255N probably benign Het
Myh6 A G 14: 55,187,965 (GRCm39) I1163T probably benign Het
Nphs1 A T 7: 30,165,540 (GRCm39) T636S possibly damaging Het
Ntsr1 T A 2: 180,142,581 (GRCm39) L124Q probably damaging Het
Obscn C T 11: 59,013,445 (GRCm39) probably null Het
P4ha2 G A 11: 54,017,238 (GRCm39) probably null Het
Pcdha9 T A 18: 37,132,164 (GRCm39) V411D probably benign Het
Pkhd1l1 A T 15: 44,389,384 (GRCm39) I1380F probably damaging Het
Plekha1 T C 7: 130,493,983 (GRCm39) V106A probably benign Het
Plekhm1 A T 11: 103,267,517 (GRCm39) V818E possibly damaging Het
Pprc1 T G 19: 46,053,809 (GRCm39) probably benign Het
Prb1c A G 6: 132,339,036 (GRCm39) S61P unknown Het
Prmt9 T C 8: 78,287,647 (GRCm39) probably benign Het
Rab26 T C 17: 24,749,373 (GRCm39) N193D possibly damaging Het
Rnf111 A G 9: 70,336,862 (GRCm39) S942P probably damaging Het
Scgb2b18 T C 7: 32,872,650 (GRCm39) T52A probably damaging Het
Syt3 C T 7: 44,042,187 (GRCm39) Q349* probably null Het
Tas2r107 T C 6: 131,636,743 (GRCm39) N102S probably benign Het
Tas2r126 T A 6: 42,411,934 (GRCm39) Y156N possibly damaging Het
Tcaf2 A T 6: 42,619,712 (GRCm39) I105N probably benign Het
Tet1 A C 10: 62,715,552 (GRCm39) M81R probably benign Het
Trerf1 A T 17: 47,625,197 (GRCm39) noncoding transcript Het
Ttn G A 2: 76,591,579 (GRCm39) T12703I probably damaging Het
Unc79 A G 12: 103,091,885 (GRCm39) K1735E possibly damaging Het
Usp54 G A 14: 20,633,419 (GRCm39) T372I possibly damaging Het
Wdr24 T C 17: 26,046,102 (GRCm39) S476P probably benign Het
Zbtb1 T C 12: 76,433,049 (GRCm39) I345T possibly damaging Het
Zcrb1 T A 15: 93,293,496 (GRCm39) I29L probably benign Het
Zfp341 T A 2: 154,472,361 (GRCm39) C315S probably damaging Het
Zfp623 C A 15: 75,820,012 (GRCm39) R323S probably benign Het
Zfp831 T A 2: 174,485,885 (GRCm39) Y187N possibly damaging Het
Other mutations in Togaram2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Togaram2 APN 17 72,031,999 (GRCm39) missense probably damaging 1.00
IGL01298:Togaram2 APN 17 72,023,508 (GRCm39) missense possibly damaging 0.71
IGL01625:Togaram2 APN 17 72,021,693 (GRCm39) missense probably benign 0.06
IGL01691:Togaram2 APN 17 72,036,485 (GRCm39) missense probably null 0.02
IGL02165:Togaram2 APN 17 72,004,861 (GRCm39) missense probably benign 0.00
IGL02186:Togaram2 APN 17 71,992,166 (GRCm39) missense possibly damaging 0.64
IGL02664:Togaram2 APN 17 72,036,234 (GRCm39) missense probably damaging 0.97
IGL02712:Togaram2 APN 17 72,011,749 (GRCm39) missense probably benign 0.04
IGL03000:Togaram2 APN 17 72,024,365 (GRCm39) missense probably benign 0.08
IGL03209:Togaram2 APN 17 72,002,740 (GRCm39) critical splice donor site probably null
R0211:Togaram2 UTSW 17 72,036,243 (GRCm39) missense probably damaging 1.00
R0212:Togaram2 UTSW 17 72,031,978 (GRCm39) missense probably damaging 1.00
R0219:Togaram2 UTSW 17 72,021,225 (GRCm39) splice site probably benign
R0268:Togaram2 UTSW 17 72,004,993 (GRCm39) critical splice donor site probably null
R0617:Togaram2 UTSW 17 72,007,504 (GRCm39) missense possibly damaging 0.87
R0831:Togaram2 UTSW 17 72,023,439 (GRCm39) missense probably damaging 1.00
R0972:Togaram2 UTSW 17 72,014,309 (GRCm39) missense probably damaging 1.00
R1635:Togaram2 UTSW 17 72,004,846 (GRCm39) missense probably benign 0.05
R1799:Togaram2 UTSW 17 71,998,450 (GRCm39) missense probably damaging 1.00
R2062:Togaram2 UTSW 17 72,023,360 (GRCm39) missense probably benign 0.26
R2414:Togaram2 UTSW 17 72,023,304 (GRCm39) intron probably benign
R2866:Togaram2 UTSW 17 72,016,592 (GRCm39) missense probably benign 0.00
R2867:Togaram2 UTSW 17 72,016,592 (GRCm39) missense probably benign 0.00
R2867:Togaram2 UTSW 17 72,016,592 (GRCm39) missense probably benign 0.00
R4066:Togaram2 UTSW 17 72,023,233 (GRCm39) intron probably benign
R4807:Togaram2 UTSW 17 72,004,918 (GRCm39) missense probably damaging 1.00
R5659:Togaram2 UTSW 17 71,994,667 (GRCm39) missense probably damaging 0.96
R5680:Togaram2 UTSW 17 71,996,204 (GRCm39) missense probably benign 0.00
R5996:Togaram2 UTSW 17 72,011,778 (GRCm39) missense probably damaging 0.99
R6619:Togaram2 UTSW 17 71,996,266 (GRCm39) missense probably damaging 0.99
R6682:Togaram2 UTSW 17 72,011,749 (GRCm39) missense probably benign 0.04
R6922:Togaram2 UTSW 17 72,014,129 (GRCm39) missense probably damaging 1.00
R6956:Togaram2 UTSW 17 72,036,183 (GRCm39) missense probably benign 0.00
R6968:Togaram2 UTSW 17 72,016,608 (GRCm39) missense probably damaging 1.00
R7007:Togaram2 UTSW 17 72,016,638 (GRCm39) missense probably damaging 0.99
R7015:Togaram2 UTSW 17 72,016,563 (GRCm39) missense possibly damaging 0.62
R7140:Togaram2 UTSW 17 72,021,761 (GRCm39) missense probably benign 0.00
R7383:Togaram2 UTSW 17 72,007,512 (GRCm39) missense probably damaging 1.00
R7691:Togaram2 UTSW 17 72,023,405 (GRCm39) missense probably benign 0.16
R7778:Togaram2 UTSW 17 72,011,746 (GRCm39) missense probably benign 0.00
R7824:Togaram2 UTSW 17 72,011,746 (GRCm39) missense probably benign 0.00
R7862:Togaram2 UTSW 17 71,996,168 (GRCm39) missense probably benign 0.00
R7864:Togaram2 UTSW 17 72,007,935 (GRCm39) missense probably damaging 0.96
R7968:Togaram2 UTSW 17 72,024,428 (GRCm39) missense probably benign 0.18
R8125:Togaram2 UTSW 17 72,023,489 (GRCm39) missense probably benign 0.16
R8227:Togaram2 UTSW 17 72,021,237 (GRCm39) nonsense probably null
R8331:Togaram2 UTSW 17 72,036,221 (GRCm39) missense probably damaging 1.00
R8354:Togaram2 UTSW 17 72,004,873 (GRCm39) missense probably benign 0.00
R8454:Togaram2 UTSW 17 72,004,873 (GRCm39) missense probably benign 0.00
R9043:Togaram2 UTSW 17 71,993,699 (GRCm39) missense probably benign 0.00
R9050:Togaram2 UTSW 17 72,007,878 (GRCm39) missense probably damaging 1.00
R9303:Togaram2 UTSW 17 71,996,408 (GRCm39) missense probably damaging 0.97
R9305:Togaram2 UTSW 17 71,996,408 (GRCm39) missense probably damaging 0.97
R9458:Togaram2 UTSW 17 72,024,246 (GRCm39) missense possibly damaging 0.93
R9660:Togaram2 UTSW 17 72,024,365 (GRCm39) missense probably damaging 0.98
R9776:Togaram2 UTSW 17 72,023,508 (GRCm39) missense possibly damaging 0.94
X0063:Togaram2 UTSW 17 72,014,192 (GRCm39) missense possibly damaging 0.91
Z1088:Togaram2 UTSW 17 72,021,275 (GRCm39) missense possibly damaging 0.87
Z1177:Togaram2 UTSW 17 72,007,997 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGACCTACCTCATTTGCATTGG -3'
(R):5'- AGGCTAAAAGTCCCTGCAGC -3'

Sequencing Primer
(F):5'- GCAGACCAATATTTCTCTTCAGATG -3'
(R):5'- TGACTGGCAGCGAAGTCCTG -3'
Posted On 2017-03-31