Incidental Mutation 'R5976:Spag17'
ID471744
Institutional Source Beutler Lab
Gene Symbol Spag17
Ensembl Gene ENSMUSG00000027867
Gene Namesperm associated antigen 17
Synonyms4931427F14Rik, PF6
MMRRC Submission 044158-MU
Accession Numbers

Genbank: NM_028892; MGI: 1921612

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5976 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location99885406-100143322 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 100095791 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 1897 (Q1897*)
Ref Sequence ENSEMBL: ENSMUSP00000134066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164539]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145279
Predicted Effect probably null
Transcript: ENSMUST00000164539
AA Change: Q1897*
SMART Domains Protein: ENSMUSP00000134066
Gene: ENSMUSG00000027867
AA Change: Q1897*

DomainStartEndE-ValueType
low complexity region 155 170 N/A INTRINSIC
low complexity region 384 400 N/A INTRINSIC
low complexity region 876 887 N/A INTRINSIC
coiled coil region 909 964 N/A INTRINSIC
coiled coil region 1079 1120 N/A INTRINSIC
low complexity region 1179 1190 N/A INTRINSIC
low complexity region 1192 1205 N/A INTRINSIC
low complexity region 1209 1220 N/A INTRINSIC
low complexity region 1223 1238 N/A INTRINSIC
low complexity region 1394 1405 N/A INTRINSIC
low complexity region 1931 1942 N/A INTRINSIC
Pfam:PapD-like 2171 2277 1.2e-15 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a central pair protein present in the axonemes of cells with a "9 + 2" organization of microtubules. The encoded protein is required for the proper function of the axoneme. Mutations in the orthologous gene in mice lead to primary ciliary dyskinesia characterized by immotile nasal and tracheal cilia, reduced clearance of nasal mucus, profound respiratory distress, hydrocephalus, and neonatal lethality within twelve hours of birth due to impaired airway mucociliary clearance. Single-nucleotide polymorphisms in this gene are associated with human height and targeted mutations lead to skeletal malformations affecting the limbs in mice, suggesting a role for this gene in skeletal development. [provided by RefSeq, Feb 2017]
PHENOTYPE: Homozygous null mice exhibit immotile respiratory cilia with axoneme structural defects, impaired mucociliary clearance, respiratory distress, pulmonary edema, disrupted alveolar epithelium, enlarged brain ventricles consistent with evolving hydrocephalus, failure to suckle, and neonatal lethality. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik G A 11: 78,284,129 A1697T probably benign Het
Ankar T C 1: 72,643,291 T1154A probably benign Het
Ankrd26 A T 6: 118,517,894 probably null Het
Arih2 A T 9: 108,607,973 *54R probably null Het
AW146154 T G 7: 41,480,297 K465T probably damaging Het
Bend3 A G 10: 43,510,544 Y311C probably benign Het
Ccdc110 A T 8: 45,943,499 Y809F possibly damaging Het
Ccnh C T 13: 85,190,863 P76L probably damaging Het
Chaf1a T A 17: 56,064,115 C667S probably damaging Het
Clca3a1 A T 3: 144,746,875 Y616N probably damaging Het
Cldn4 A G 5: 134,946,556 C64R probably damaging Het
Crybg2 TGGAGGAGGAGGAGGAGGAG TGGAGGAGGAGGAGGAG 4: 134,074,526 probably benign Het
Dclk2 C A 3: 86,787,225 R752L possibly damaging Het
Dzank1 C A 2: 144,501,489 G318W probably damaging Het
Edem1 T A 6: 108,842,962 I236K probably damaging Het
Eif4e1b T C 13: 54,784,822 F75L probably damaging Het
Elmo3 A G 8: 105,307,647 Y266C probably damaging Het
Enpep A G 3: 129,299,124 S509P probably damaging Het
Exoc8 A G 8: 124,896,653 M325T probably benign Het
Fah A G 7: 84,594,741 M270T probably benign Het
Gabbr1 T C 17: 37,067,862 L532P probably damaging Het
Gm10770 T A 2: 150,179,400 K66* probably null Het
Gprc5c A T 11: 114,864,487 Q330L possibly damaging Het
Grin3a T A 4: 49,792,602 H377L probably damaging Het
Hipk3 T C 2: 104,471,184 E221G probably damaging Het
Hsd17b6 T A 10: 127,991,439 M255L probably benign Het
Ighv1-7 T A 12: 114,538,759 E29D probably benign Het
Ing3 T A 6: 21,971,174 S326T probably benign Het
Ipo7 T C 7: 110,048,807 L632P probably damaging Het
Kdm6b A G 11: 69,403,788 probably null Het
Kif21a T G 15: 90,935,812 D1583A probably damaging Het
Lama2 C T 10: 27,190,676 V1070I probably benign Het
Lrp1 A T 10: 127,583,901 S946R probably damaging Het
Lrrc37a A G 11: 103,499,071 S1843P possibly damaging Het
Ltbp1 T C 17: 75,290,083 Y517H probably damaging Het
Map2k4 T A 11: 65,709,952 N51I probably benign Het
Mfsd2b G T 12: 4,866,522 A216D probably damaging Het
Nbea T C 3: 55,853,847 T2025A probably benign Het
Neb A G 2: 52,216,916 V4162A possibly damaging Het
Nr3c1 A T 18: 39,421,549 F599I probably damaging Het
Nsun2 T G 13: 69,623,152 probably null Het
Olfr479 T A 7: 108,055,798 M272K possibly damaging Het
Olfr884 G T 9: 38,047,701 V160F possibly damaging Het
Otoa T A 7: 121,127,713 W524R probably benign Het
Paip1 T A 13: 119,456,997 D182E probably damaging Het
Pde1a G A 2: 79,868,242 Q415* probably null Het
Pfkfb2 T A 1: 130,708,079 K72* probably null Het
Pigg A G 5: 108,332,191 E444G probably null Het
Plec T C 15: 76,189,037 Y669C probably damaging Het
Ptp4a3 T C 15: 73,756,036 V94A possibly damaging Het
Ptprg A G 14: 12,211,625 E969G probably damaging Het
R3hcc1l T A 19: 42,563,350 V262E probably benign Het
Ranbp3l T G 15: 9,002,093 F65C possibly damaging Het
Rbm19 T A 5: 120,140,307 S718R probably benign Het
Recql4 C A 15: 76,709,424 R162L probably benign Het
Rest T C 5: 77,268,272 L111P probably benign Het
Rgma T C 7: 73,409,468 S13P probably damaging Het
Rogdi T A 16: 5,013,311 I31F probably benign Het
Serpinb9e T A 13: 33,255,129 D179E probably benign Het
Slc1a5 T C 7: 16,795,882 C409R probably damaging Het
Slc25a38 A G 9: 120,116,547 T38A probably damaging Het
St7 C A 6: 17,694,222 A4E possibly damaging Het
Tbcel T A 9: 42,439,203 I263F possibly damaging Het
Tmtc3 A G 10: 100,476,672 V103A probably benign Het
Tnc G A 4: 64,018,166 P178S probably benign Het
Vwf A G 6: 125,603,463 D558G Het
Zfp541 A G 7: 16,076,419 K127R probably benign Het
Other mutations in Spag17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Spag17 APN 3 100063375 missense probably benign 0.00
IGL01143:Spag17 APN 3 99939298 missense probably benign 0.00
IGL01329:Spag17 APN 3 100095549 missense probably benign 0.16
IGL01393:Spag17 APN 3 100027610 missense possibly damaging 0.53
IGL01617:Spag17 APN 3 100109508 missense possibly damaging 0.65
IGL01705:Spag17 APN 3 100022730 missense probably benign 0.01
IGL01928:Spag17 APN 3 99940074 splice site probably benign
IGL01981:Spag17 APN 3 100058833 missense probably benign 0.03
IGL02435:Spag17 APN 3 99982444 missense possibly damaging 0.53
IGL02452:Spag17 APN 3 100027391 missense probably benign 0.00
IGL02465:Spag17 APN 3 100075871 missense probably damaging 0.96
IGL02615:Spag17 APN 3 100072085 missense probably benign 0.09
IGL02751:Spag17 APN 3 100010794 nonsense probably null
IGL02803:Spag17 APN 3 100109397 missense probably benign
IGL02898:Spag17 APN 3 100101386 missense probably benign 0.00
IGL03037:Spag17 APN 3 100072170 splice site probably null
IGL03068:Spag17 APN 3 100080205 missense probably benign 0.35
IGL03131:Spag17 APN 3 100010759 missense possibly damaging 0.85
IGL03224:Spag17 APN 3 100010840 missense possibly damaging 0.53
FR4342:Spag17 UTSW 3 100056249 small insertion probably benign
FR4342:Spag17 UTSW 3 100056252 small insertion probably benign
FR4548:Spag17 UTSW 3 100056254 small insertion probably benign
FR4589:Spag17 UTSW 3 100056245 small insertion probably benign
FR4589:Spag17 UTSW 3 100056258 small insertion probably benign
FR4737:Spag17 UTSW 3 100056257 small insertion probably benign
FR4976:Spag17 UTSW 3 100056254 small insertion probably benign
FR4976:Spag17 UTSW 3 100056255 small insertion probably benign
N/A:Spag17 UTSW 3 99982254 splice site probably benign
PIT4504001:Spag17 UTSW 3 100103110 critical splice acceptor site probably null
PIT4514001:Spag17 UTSW 3 100013211 missense possibly damaging 0.53
R0107:Spag17 UTSW 3 100050787 missense possibly damaging 0.72
R0230:Spag17 UTSW 3 100106827 missense probably benign 0.08
R0243:Spag17 UTSW 3 100085368 missense probably benign 0.04
R0321:Spag17 UTSW 3 100101403 missense probably damaging 0.99
R0375:Spag17 UTSW 3 100027590 missense probably benign
R0417:Spag17 UTSW 3 100065554 missense probably benign 0.11
R0490:Spag17 UTSW 3 99982411 missense probably damaging 0.97
R0537:Spag17 UTSW 3 100125302 missense probably damaging 0.98
R0714:Spag17 UTSW 3 100080156 missense probably damaging 0.97
R0844:Spag17 UTSW 3 100004785 missense probably benign
R0919:Spag17 UTSW 3 100071943 splice site probably benign
R0926:Spag17 UTSW 3 100072116 missense probably benign
R1037:Spag17 UTSW 3 100103117 missense probably benign 0.01
R1075:Spag17 UTSW 3 100093676 missense probably damaging 0.99
R1109:Spag17 UTSW 3 100027351 missense possibly damaging 0.86
R1213:Spag17 UTSW 3 100095638 missense probably benign 0.01
R1221:Spag17 UTSW 3 99982268 missense possibly damaging 0.72
R1576:Spag17 UTSW 3 99939363 missense possibly damaging 0.73
R1586:Spag17 UTSW 3 100021752 missense possibly damaging 0.53
R1768:Spag17 UTSW 3 100027352 missense possibly damaging 0.53
R1782:Spag17 UTSW 3 100010754 missense probably benign 0.02
R1789:Spag17 UTSW 3 99939356 missense possibly damaging 0.73
R1945:Spag17 UTSW 3 99939982 missense probably benign
R2065:Spag17 UTSW 3 100013208 missense probably benign 0.03
R2118:Spag17 UTSW 3 100049240 missense possibly damaging 0.72
R2265:Spag17 UTSW 3 100061866 splice site probably null
R2266:Spag17 UTSW 3 100061866 splice site probably null
R2267:Spag17 UTSW 3 100061866 splice site probably null
R2268:Spag17 UTSW 3 100061866 splice site probably null
R2271:Spag17 UTSW 3 100106797 missense probably damaging 1.00
R2389:Spag17 UTSW 3 100106837 missense probably benign 0.27
R2420:Spag17 UTSW 3 100027619 missense probably benign
R2422:Spag17 UTSW 3 100027619 missense probably benign
R2423:Spag17 UTSW 3 100103456 missense probably benign
R3407:Spag17 UTSW 3 100085299 missense probably benign 0.09
R3801:Spag17 UTSW 3 100053853 missense possibly damaging 0.53
R3856:Spag17 UTSW 3 100106759 missense probably damaging 1.00
R4021:Spag17 UTSW 3 100049230 missense probably benign 0.00
R4022:Spag17 UTSW 3 100049230 missense probably benign 0.00
R4408:Spag17 UTSW 3 100103378 missense probably benign
R4468:Spag17 UTSW 3 100085366 missense probably damaging 0.98
R4540:Spag17 UTSW 3 100088381 missense probably damaging 1.00
R4621:Spag17 UTSW 3 100103243 missense probably benign 0.08
R4622:Spag17 UTSW 3 100103243 missense probably benign 0.08
R4756:Spag17 UTSW 3 100103385 missense possibly damaging 0.68
R4797:Spag17 UTSW 3 99984479 missense possibly damaging 0.70
R4855:Spag17 UTSW 3 100063333 missense probably benign 0.02
R4887:Spag17 UTSW 3 100050831 missense probably damaging 1.00
R4962:Spag17 UTSW 3 100027623 missense probably benign
R5030:Spag17 UTSW 3 100085341 nonsense probably null
R5042:Spag17 UTSW 3 100072149 missense probably damaging 1.00
R5074:Spag17 UTSW 3 100080118 missense possibly damaging 0.94
R5195:Spag17 UTSW 3 100101388 missense probably benign 0.16
R5200:Spag17 UTSW 3 100063471 nonsense probably null
R5267:Spag17 UTSW 3 100061948 missense probably damaging 0.98
R5360:Spag17 UTSW 3 100109410 missense probably benign 0.00
R5444:Spag17 UTSW 3 100056152 missense probably benign 0.06
R5498:Spag17 UTSW 3 100103345 missense possibly damaging 0.83
R5503:Spag17 UTSW 3 100027244 missense possibly damaging 0.72
R5540:Spag17 UTSW 3 100056272 missense possibly damaging 0.91
R5547:Spag17 UTSW 3 100056152 missense probably benign 0.06
R5575:Spag17 UTSW 3 100053822 missense possibly damaging 0.85
R5629:Spag17 UTSW 3 100080119 missense probably benign 0.33
R5639:Spag17 UTSW 3 100056166 missense probably damaging 1.00
R5842:Spag17 UTSW 3 99939250 missense possibly damaging 0.85
R6082:Spag17 UTSW 3 100124185 missense possibly damaging 0.46
R6228:Spag17 UTSW 3 100022602 missense probably benign 0.33
R6254:Spag17 UTSW 3 100065585 missense probably benign 0.03
R6321:Spag17 UTSW 3 100088427 missense probably benign 0.05
R6446:Spag17 UTSW 3 100103132 missense probably benign
R6687:Spag17 UTSW 3 100092950 missense probably benign 0.07
R6853:Spag17 UTSW 3 100013235 missense possibly damaging 0.86
R6946:Spag17 UTSW 3 100004683 missense possibly damaging 0.53
R6953:Spag17 UTSW 3 100034975 missense possibly damaging 0.53
R7038:Spag17 UTSW 3 99984609 missense probably benign 0.00
R7084:Spag17 UTSW 3 99939270 missense probably benign 0.18
R7126:Spag17 UTSW 3 100101435 missense probably benign 0.00
R7144:Spag17 UTSW 3 100027401 splice site probably null
R7198:Spag17 UTSW 3 100095572 missense probably benign 0.02
R7318:Spag17 UTSW 3 99939983 missense probably benign 0.00
R7403:Spag17 UTSW 3 99939375 missense possibly damaging 0.53
R7409:Spag17 UTSW 3 100027231 missense possibly damaging 0.73
R7409:Spag17 UTSW 3 100034159 missense probably benign 0.00
R7537:Spag17 UTSW 3 99939247 missense possibly damaging 0.96
R7609:Spag17 UTSW 3 100095595 nonsense probably null
X0025:Spag17 UTSW 3 100101451 missense probably benign 0.31
Z1088:Spag17 UTSW 3 100095630 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TTCGGCTCCAAAATGTTCACC -3'
(R):5'- GATCTATCTAAGGGCCCAACAG -3'

Sequencing Primer
(F):5'- TGTTCACCAGACAGCTACTCTAAAG -3'
(R):5'- AGGTTCCTCCACTTTGGT -3'
Posted On2017-03-31