Incidental Mutation 'R5976:Vwf'
ID 471760
Institutional Source Beutler Lab
Gene Symbol Vwf
Ensembl Gene ENSMUSG00000001930
Gene Name Von Willebrand factor
Synonyms B130011O06Rik, 6820430P06Rik
MMRRC Submission 044158-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.138) question?
Stock # R5976 (G1)
Quality Score 210
Status Not validated
Chromosome 6
Chromosomal Location 125529911-125663642 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 125580426 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 558 (D558G)
Ref Sequence ENSEMBL: ENSMUSP00000107873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112254]
AlphaFold no structure available at present
Predicted Effect not run
Transcript: ENSMUST00000001995
AA Change: D558G
SMART Domains Protein: ENSMUSP00000001995
Gene: ENSMUSG00000001930
AA Change: D558G

DomainStartEndE-ValueType
VWD 20 178 3.43e-35 SMART
C8 218 292 1.11e-21 SMART
Pfam:TIL 295 348 2.9e-14 PFAM
VWC 350 410 8.71e-1 SMART
VWD 377 540 2.93e-52 SMART
C8 577 649 3.82e-25 SMART
Pfam:TIL 652 707 5.7e-14 PFAM
EGF_like 787 822 4.37e1 SMART
VWC 829 898 3.29e-3 SMART
VWD 856 1012 5.15e-39 SMART
C8 1053 1127 1.01e-33 SMART
Pfam:TIL 1141 1196 3.6e-9 PFAM
VWA 1275 1458 1.81e-20 SMART
low complexity region 1461 1474 N/A INTRINSIC
VWA 1496 1669 8.43e-39 SMART
VWA 1689 1872 2.83e-31 SMART
VWC 1879 1946 2.99e0 SMART
VWD 1938 2101 5.03e-42 SMART
C8 2132 2200 1.29e-13 SMART
Pfam:TIL 2203 2254 1.2e-7 PFAM
VWC 2257 2325 3.16e-16 SMART
low complexity region 2414 2425 N/A INTRINSIC
VWC 2431 2494 2.61e-17 SMART
VWC 2510 2574 3.37e0 SMART
VWC 2582 2644 2.55e-11 SMART
CT 2727 2812 1.37e-31 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000107873
Gene: ENSMUSG00000001930
AA Change: D558G

DomainStartEndE-ValueType
VWD 23 181 3.43e-35 SMART
C8 221 295 1.11e-21 SMART
Pfam:TIL 298 351 6.9e-15 PFAM
VWC 353 413 8.71e-1 SMART
VWD 380 543 2.93e-52 SMART
C8 580 652 3.82e-25 SMART
Pfam:TIL 655 710 4.1e-14 PFAM
EGF_like 790 825 4.37e1 SMART
VWC 832 901 3.29e-3 SMART
VWD 859 1015 5.15e-39 SMART
C8 1056 1130 1.01e-33 SMART
Pfam:TIL 1144 1199 1.3e-9 PFAM
VWA 1278 1461 1.81e-20 SMART
low complexity region 1464 1477 N/A INTRINSIC
VWA 1499 1672 8.43e-39 SMART
VWA 1692 1875 2.83e-31 SMART
VWC 1882 1949 2.99e0 SMART
VWD 1941 2104 5.03e-42 SMART
C8 2135 2203 1.29e-13 SMART
Pfam:TIL 2206 2257 8.3e-8 PFAM
VWC 2260 2328 3.16e-16 SMART
low complexity region 2417 2428 N/A INTRINSIC
VWC 2434 2497 2.61e-17 SMART
VWC 2513 2577 3.37e0 SMART
VWC 2585 2647 2.55e-11 SMART
CT 2730 2815 1.37e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134073
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150548
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein involved in hemostasis. The encoded preproprotein is proteolytically processed following assembly into large multimeric complexes. These complexes function in the adhesion of platelets to sites of vascular injury and the transport of various proteins in the blood. Mutations in this gene result in von Willebrand disease, an inherited bleeding disorder. An unprocessed pseudogene has been found on chromosome 22. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous null mutants exhibit hemostatic and thrombotic defects similar to human von Willebrand disease. Mutants have prolonged bleeding time, newborns occasionally show fatal intra-abdominal bleeding and some adults have detectable fecal occult blood. [provided by MGI curators]
Allele List at MGI

All alleles(33) : Targeted, knock-out(1) Gene trapped(32)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankar T C 1: 72,682,450 (GRCm39) T1154A probably benign Het
Ankrd26 A T 6: 118,494,855 (GRCm39) probably null Het
Arih2 A T 9: 108,485,172 (GRCm39) *54R probably null Het
AW146154 T G 7: 41,129,721 (GRCm39) K465T probably damaging Het
Bend3 A G 10: 43,386,540 (GRCm39) Y311C probably benign Het
Bltp2 G A 11: 78,174,955 (GRCm39) A1697T probably benign Het
Ccdc110 A T 8: 46,396,536 (GRCm39) Y809F possibly damaging Het
Ccnh C T 13: 85,338,982 (GRCm39) P76L probably damaging Het
Chaf1a T A 17: 56,371,115 (GRCm39) C667S probably damaging Het
Clca3a1 A T 3: 144,452,636 (GRCm39) Y616N probably damaging Het
Cldn4 A G 5: 134,975,410 (GRCm39) C64R probably damaging Het
Crybg2 TGGAGGAGGAGGAGGAGGAG TGGAGGAGGAGGAGGAG 4: 133,801,837 (GRCm39) probably benign Het
Dclk2 C A 3: 86,694,532 (GRCm39) R752L possibly damaging Het
Dzank1 C A 2: 144,343,409 (GRCm39) G318W probably damaging Het
Edem1 T A 6: 108,819,923 (GRCm39) I236K probably damaging Het
Eif4e1b T C 13: 54,932,635 (GRCm39) F75L probably damaging Het
Elmo3 A G 8: 106,034,279 (GRCm39) Y266C probably damaging Het
Enpep A G 3: 129,092,773 (GRCm39) S509P probably damaging Het
Exoc8 A G 8: 125,623,392 (GRCm39) M325T probably benign Het
Fah A G 7: 84,243,949 (GRCm39) M270T probably benign Het
Gabbr1 T C 17: 37,378,754 (GRCm39) L532P probably damaging Het
Gm10770 T A 2: 150,021,320 (GRCm39) K66* probably null Het
Gprc5c A T 11: 114,755,313 (GRCm39) Q330L possibly damaging Het
Grin3a T A 4: 49,792,602 (GRCm39) H377L probably damaging Het
Hipk3 T C 2: 104,301,529 (GRCm39) E221G probably damaging Het
Hsd17b6 T A 10: 127,827,308 (GRCm39) M255L probably benign Het
Ighv1-7 T A 12: 114,502,379 (GRCm39) E29D probably benign Het
Ing3 T A 6: 21,971,173 (GRCm39) S326T probably benign Het
Ipo7 T C 7: 109,648,014 (GRCm39) L632P probably damaging Het
Kdm6b A G 11: 69,294,614 (GRCm39) probably null Het
Kif21a T G 15: 90,820,015 (GRCm39) D1583A probably damaging Het
Lama2 C T 10: 27,066,672 (GRCm39) V1070I probably benign Het
Lrp1 A T 10: 127,419,770 (GRCm39) S946R probably damaging Het
Lrrc37a A G 11: 103,389,897 (GRCm39) S1843P possibly damaging Het
Ltbp1 T C 17: 75,597,078 (GRCm39) Y517H probably damaging Het
Map2k4 T A 11: 65,600,778 (GRCm39) N51I probably benign Het
Mfsd2b G T 12: 4,916,522 (GRCm39) A216D probably damaging Het
Nbea T C 3: 55,761,268 (GRCm39) T2025A probably benign Het
Neb A G 2: 52,106,928 (GRCm39) V4162A possibly damaging Het
Nr3c1 A T 18: 39,554,602 (GRCm39) F599I probably damaging Het
Nsun2 T G 13: 69,771,271 (GRCm39) probably null Het
Or10ab4 T A 7: 107,655,005 (GRCm39) M272K possibly damaging Het
Or8b37 G T 9: 37,958,997 (GRCm39) V160F possibly damaging Het
Otoa T A 7: 120,726,936 (GRCm39) W524R probably benign Het
Paip1 T A 13: 119,593,533 (GRCm39) D182E probably damaging Het
Pde1a G A 2: 79,698,586 (GRCm39) Q415* probably null Het
Pfkfb2 T A 1: 130,635,816 (GRCm39) K72* probably null Het
Pigg A G 5: 108,480,057 (GRCm39) E444G probably null Het
Plec T C 15: 76,073,237 (GRCm39) Y669C probably damaging Het
Ptp4a3 T C 15: 73,627,885 (GRCm39) V94A possibly damaging Het
Ptprg A G 14: 12,211,625 (GRCm38) E969G probably damaging Het
R3hcc1l T A 19: 42,551,789 (GRCm39) V262E probably benign Het
Ranbp3l T G 15: 9,030,916 (GRCm39) F65C possibly damaging Het
Rbm19 T A 5: 120,278,372 (GRCm39) S718R probably benign Het
Recql4 C A 15: 76,593,624 (GRCm39) R162L probably benign Het
Rest T C 5: 77,416,119 (GRCm39) L111P probably benign Het
Rgma T C 7: 73,059,216 (GRCm39) S13P probably damaging Het
Rogdi T A 16: 4,831,175 (GRCm39) I31F probably benign Het
Serpinb9e T A 13: 33,439,112 (GRCm39) D179E probably benign Het
Slc1a5 T C 7: 16,529,807 (GRCm39) C409R probably damaging Het
Slc25a38 A G 9: 119,945,613 (GRCm39) T38A probably damaging Het
Spag17 C T 3: 100,003,107 (GRCm39) Q1897* probably null Het
St7 C A 6: 17,694,221 (GRCm39) A4E possibly damaging Het
Tbcel T A 9: 42,350,499 (GRCm39) I263F possibly damaging Het
Tmtc3 A G 10: 100,312,534 (GRCm39) V103A probably benign Het
Tnc G A 4: 63,936,403 (GRCm39) P178S probably benign Het
Zfp541 A G 7: 15,810,344 (GRCm39) K127R probably benign Het
Other mutations in Vwf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Vwf APN 6 125,635,835 (GRCm39) missense unknown
IGL00561:Vwf APN 6 125,619,684 (GRCm39) missense possibly damaging 0.88
IGL01104:Vwf APN 6 125,660,519 (GRCm39) missense probably damaging 1.00
IGL01404:Vwf APN 6 125,654,933 (GRCm39) missense probably damaging 1.00
IGL01539:Vwf APN 6 125,567,225 (GRCm39) missense possibly damaging 0.85
IGL01550:Vwf APN 6 125,656,252 (GRCm39) missense probably benign 0.00
IGL01563:Vwf APN 6 125,568,128 (GRCm39) missense probably damaging 1.00
IGL01637:Vwf APN 6 125,622,699 (GRCm39) missense probably damaging 1.00
IGL01720:Vwf APN 6 125,619,798 (GRCm39) missense possibly damaging 0.69
IGL01834:Vwf APN 6 125,567,133 (GRCm39) splice site probably benign
IGL02103:Vwf APN 6 125,623,318 (GRCm39) missense probably damaging 1.00
IGL02120:Vwf APN 6 125,592,997 (GRCm39) missense probably benign 0.26
IGL02174:Vwf APN 6 125,532,358 (GRCm39) missense probably damaging 1.00
IGL02203:Vwf APN 6 125,619,369 (GRCm39) missense probably damaging 1.00
IGL02420:Vwf APN 6 125,654,879 (GRCm39) missense probably benign 0.00
IGL02723:Vwf APN 6 125,619,893 (GRCm39) missense possibly damaging 0.85
IGL02818:Vwf APN 6 125,640,511 (GRCm39) missense probably benign
IGL02931:Vwf APN 6 125,592,931 (GRCm39) missense possibly damaging 0.68
IGL03015:Vwf APN 6 125,661,101 (GRCm39) splice site probably benign
IGL03038:Vwf APN 6 125,581,120 (GRCm39) missense possibly damaging 0.92
IGL03060:Vwf APN 6 125,640,523 (GRCm39) missense probably damaging 1.00
IGL03114:Vwf APN 6 125,576,326 (GRCm39) nonsense probably null
IGL03266:Vwf APN 6 125,655,040 (GRCm39) splice site probably benign
gingerman UTSW 6 125,639,926 (GRCm39) critical splice acceptor site probably null
R0605_vwf_644 UTSW 6 125,662,800 (GRCm39) missense probably benign 0.02
R1575_Vwf_091 UTSW 6 125,640,534 (GRCm39) nonsense probably null
R1628_Vwf_608 UTSW 6 125,624,701 (GRCm39) unclassified probably benign
R1669_Vwf_448 UTSW 6 125,624,869 (GRCm39) missense possibly damaging 0.92
R1833_Vwf_948 UTSW 6 125,619,000 (GRCm39) missense probably benign 0.14
R2130_vwf_946 UTSW 6 125,634,020 (GRCm39) missense probably damaging 1.00
R6360_Vwf_065 UTSW 6 125,660,489 (GRCm39) missense probably benign 0.13
R7900_Vwf_938 UTSW 6 125,605,439 (GRCm39) critical splice donor site probably null
Russiahouse UTSW 6 125,616,304 (GRCm39) nonsense probably null
B5639:Vwf UTSW 6 125,619,947 (GRCm39) missense probably damaging 1.00
R0025:Vwf UTSW 6 125,659,775 (GRCm39) missense probably benign 0.05
R0025:Vwf UTSW 6 125,659,775 (GRCm39) missense probably benign 0.05
R0087:Vwf UTSW 6 125,622,917 (GRCm39) missense probably benign 0.03
R0194:Vwf UTSW 6 125,620,260 (GRCm39) missense probably benign
R0206:Vwf UTSW 6 125,614,419 (GRCm39) missense probably damaging 1.00
R0233:Vwf UTSW 6 125,663,473 (GRCm39) missense possibly damaging 0.91
R0233:Vwf UTSW 6 125,663,473 (GRCm39) missense possibly damaging 0.91
R0390:Vwf UTSW 6 125,603,324 (GRCm39) nonsense probably null
R0427:Vwf UTSW 6 125,650,902 (GRCm39) missense probably benign
R0437:Vwf UTSW 6 125,543,281 (GRCm39) missense probably damaging 1.00
R0470:Vwf UTSW 6 125,605,391 (GRCm39) missense possibly damaging 0.70
R0499:Vwf UTSW 6 125,615,077 (GRCm39) missense probably benign 0.10
R0554:Vwf UTSW 6 125,619,744 (GRCm39) missense probably benign 0.13
R0605:Vwf UTSW 6 125,662,800 (GRCm39) missense probably benign 0.02
R0711:Vwf UTSW 6 125,603,234 (GRCm39) missense probably benign 0.01
R0723:Vwf UTSW 6 125,543,225 (GRCm39) missense probably benign 0.01
R0973:Vwf UTSW 6 125,619,969 (GRCm39) missense probably damaging 1.00
R1054:Vwf UTSW 6 125,567,190 (GRCm39) missense probably damaging 1.00
R1115:Vwf UTSW 6 125,632,028 (GRCm39) missense unknown
R1156:Vwf UTSW 6 125,614,451 (GRCm39) missense probably damaging 1.00
R1191:Vwf UTSW 6 125,576,215 (GRCm39) missense probably damaging 1.00
R1240:Vwf UTSW 6 125,580,271 (GRCm39) splice site probably null
R1398:Vwf UTSW 6 125,580,420 (GRCm39) missense probably benign 0.02
R1435:Vwf UTSW 6 125,619,212 (GRCm39) nonsense probably null
R1528:Vwf UTSW 6 125,585,254 (GRCm39) missense possibly damaging 0.69
R1575:Vwf UTSW 6 125,640,534 (GRCm39) nonsense probably null
R1575:Vwf UTSW 6 125,632,214 (GRCm39) missense unknown
R1628:Vwf UTSW 6 125,624,701 (GRCm39) unclassified probably benign
R1669:Vwf UTSW 6 125,624,869 (GRCm39) missense possibly damaging 0.92
R1699:Vwf UTSW 6 125,662,863 (GRCm39) missense possibly damaging 0.74
R1699:Vwf UTSW 6 125,620,032 (GRCm39) missense probably damaging 1.00
R1725:Vwf UTSW 6 125,623,245 (GRCm39) missense probably benign 0.05
R1742:Vwf UTSW 6 125,644,513 (GRCm39) missense probably benign 0.02
R1809:Vwf UTSW 6 125,567,138 (GRCm39) splice site probably benign
R1833:Vwf UTSW 6 125,619,000 (GRCm39) missense probably benign 0.14
R1866:Vwf UTSW 6 125,644,492 (GRCm39) missense possibly damaging 0.62
R1870:Vwf UTSW 6 125,619,902 (GRCm39) missense probably damaging 1.00
R1874:Vwf UTSW 6 125,605,335 (GRCm39) missense probably benign 0.00
R1941:Vwf UTSW 6 125,616,242 (GRCm39) missense possibly damaging 0.64
R2061:Vwf UTSW 6 125,568,151 (GRCm39) missense probably damaging 0.98
R2103:Vwf UTSW 6 125,623,293 (GRCm39) missense probably benign 0.31
R2104:Vwf UTSW 6 125,623,293 (GRCm39) missense probably benign 0.31
R2130:Vwf UTSW 6 125,634,020 (GRCm39) missense probably damaging 1.00
R2159:Vwf UTSW 6 125,603,304 (GRCm39) missense probably damaging 0.99
R2178:Vwf UTSW 6 125,619,095 (GRCm39) missense possibly damaging 0.90
R2656:Vwf UTSW 6 125,532,324 (GRCm39) missense probably benign 0.00
R2913:Vwf UTSW 6 125,662,809 (GRCm39) missense probably benign 0.08
R2917:Vwf UTSW 6 125,585,106 (GRCm39) missense probably benign 0.07
R3726:Vwf UTSW 6 125,654,911 (GRCm39) utr 3 prime probably benign
R3735:Vwf UTSW 6 125,565,576 (GRCm39) missense probably damaging 1.00
R3774:Vwf UTSW 6 125,626,062 (GRCm39) splice site probably null
R3934:Vwf UTSW 6 125,532,462 (GRCm39) missense probably damaging 1.00
R4291:Vwf UTSW 6 125,619,285 (GRCm39) missense probably damaging 1.00
R4384:Vwf UTSW 6 125,632,079 (GRCm39) missense unknown
R4743:Vwf UTSW 6 125,661,054 (GRCm39) critical splice acceptor site probably null
R4760:Vwf UTSW 6 125,547,567 (GRCm39) missense probably damaging 1.00
R4776:Vwf UTSW 6 125,543,268 (GRCm39) missense possibly damaging 0.53
R4791:Vwf UTSW 6 125,620,326 (GRCm39) missense
R4871:Vwf UTSW 6 125,663,425 (GRCm39) missense probably benign 0.25
R4894:Vwf UTSW 6 125,622,897 (GRCm39) nonsense probably null
R4963:Vwf UTSW 6 125,644,446 (GRCm39) nonsense probably null
R5010:Vwf UTSW 6 125,543,220 (GRCm39) missense probably benign 0.15
R5289:Vwf UTSW 6 125,644,473 (GRCm39) utr 3 prime probably benign
R5512:Vwf UTSW 6 125,650,850 (GRCm39) utr 3 prime probably benign
R5523:Vwf UTSW 6 125,620,005 (GRCm39) missense
R5642:Vwf UTSW 6 125,580,381 (GRCm39) missense
R5860:Vwf UTSW 6 125,656,228 (GRCm39) utr 3 prime probably benign
R5860:Vwf UTSW 6 125,620,053 (GRCm39) missense
R5896:Vwf UTSW 6 125,655,725 (GRCm39) critical splice acceptor site probably null
R5926:Vwf UTSW 6 125,581,137 (GRCm39) missense probably damaging 1.00
R6053:Vwf UTSW 6 125,577,628 (GRCm39) missense probably benign 0.21
R6151:Vwf UTSW 6 125,634,028 (GRCm39) missense unknown
R6179:Vwf UTSW 6 125,626,252 (GRCm39) missense unknown
R6181:Vwf UTSW 6 125,543,109 (GRCm39) missense probably damaging 0.98
R6234:Vwf UTSW 6 125,634,128 (GRCm39) missense unknown
R6360:Vwf UTSW 6 125,660,489 (GRCm39) missense probably benign 0.13
R6412:Vwf UTSW 6 125,656,279 (GRCm39) missense probably benign 0.00
R6464:Vwf UTSW 6 125,616,363 (GRCm39) critical splice donor site probably null
R6522:Vwf UTSW 6 125,639,926 (GRCm39) critical splice acceptor site probably null
R6766:Vwf UTSW 6 125,616,339 (GRCm39) missense unknown
R6856:Vwf UTSW 6 125,619,113 (GRCm39) nonsense probably null
R6877:Vwf UTSW 6 125,634,164 (GRCm39) missense possibly damaging 0.48
R6896:Vwf UTSW 6 125,543,157 (GRCm39) missense probably damaging 1.00
R7113:Vwf UTSW 6 125,632,007 (GRCm39) missense
R7287:Vwf UTSW 6 125,614,430 (GRCm39) missense
R7359:Vwf UTSW 6 125,543,220 (GRCm39) missense
R7509:Vwf UTSW 6 125,619,132 (GRCm39) missense
R7519:Vwf UTSW 6 125,644,506 (GRCm39) missense
R7545:Vwf UTSW 6 125,591,060 (GRCm39) missense
R7549:Vwf UTSW 6 125,603,230 (GRCm39) missense
R7593:Vwf UTSW 6 125,624,731 (GRCm39) missense
R7635:Vwf UTSW 6 125,659,697 (GRCm39) missense
R7793:Vwf UTSW 6 125,663,483 (GRCm39) missense
R7802:Vwf UTSW 6 125,643,640 (GRCm39) missense
R7824:Vwf UTSW 6 125,635,778 (GRCm39) missense
R7849:Vwf UTSW 6 125,633,766 (GRCm39) missense
R7900:Vwf UTSW 6 125,605,439 (GRCm39) critical splice donor site probably null
R7919:Vwf UTSW 6 125,624,822 (GRCm39) missense
R7966:Vwf UTSW 6 125,616,304 (GRCm39) nonsense probably null
R8101:Vwf UTSW 6 125,547,522 (GRCm39) nonsense probably null
R8162:Vwf UTSW 6 125,622,799 (GRCm39) splice site probably null
R8345:Vwf UTSW 6 125,656,265 (GRCm39) missense
R8853:Vwf UTSW 6 125,634,227 (GRCm39) missense
R9027:Vwf UTSW 6 125,643,626 (GRCm39) missense
R9065:Vwf UTSW 6 125,623,262 (GRCm39) missense
R9068:Vwf UTSW 6 125,625,792 (GRCm39) unclassified probably benign
R9128:Vwf UTSW 6 125,619,693 (GRCm39) missense
R9136:Vwf UTSW 6 125,576,356 (GRCm39) splice site probably benign
R9164:Vwf UTSW 6 125,542,806 (GRCm39) missense
R9177:Vwf UTSW 6 125,581,254 (GRCm39) missense
R9334:Vwf UTSW 6 125,654,909 (GRCm39) missense
R9508:Vwf UTSW 6 125,532,471 (GRCm39) missense
R9553:Vwf UTSW 6 125,577,662 (GRCm39) missense
R9660:Vwf UTSW 6 125,568,670 (GRCm39) missense possibly damaging 0.61
R9706:Vwf UTSW 6 125,601,536 (GRCm39) missense
R9708:Vwf UTSW 6 125,634,053 (GRCm39) missense
R9712:Vwf UTSW 6 125,601,536 (GRCm39) missense
R9714:Vwf UTSW 6 125,601,536 (GRCm39) missense
R9728:Vwf UTSW 6 125,568,670 (GRCm39) missense possibly damaging 0.61
R9758:Vwf UTSW 6 125,603,230 (GRCm39) missense
X0021:Vwf UTSW 6 125,623,294 (GRCm39) missense probably damaging 1.00
X0065:Vwf UTSW 6 125,580,396 (GRCm39) missense probably null 0.05
Z1176:Vwf UTSW 6 125,580,271 (GRCm39) splice site probably null
Z1176:Vwf UTSW 6 125,568,194 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- AGTGGAACCATTGTGGCACTG -3'
(R):5'- CATGGATGGAGGGTGTTCAATAAAC -3'

Sequencing Primer
(F):5'- CATTGTGGCACTGGGGGAC -3'
(R):5'- AATGTGGATCTCAACGGCC -3'
Posted On 2017-03-31