Incidental Mutation 'R5976:Vwf'
ID 471760
Institutional Source Beutler Lab
Gene Symbol Vwf
Ensembl Gene ENSMUSG00000001930
Gene Name Von Willebrand factor
Synonyms 6820430P06Rik, B130011O06Rik
MMRRC Submission 044158-MU
Accession Numbers

Genbank: NM_011708; MGI: 98941
Essential gene? Probably non essential (E-score: 0.173) question?
Stock # R5976 (G1)
Quality Score 210
Status Not validated
Chromosome 6
Chromosomal Location 125546774-125686679 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 125603463 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 558 (D558G)
Ref Sequence ENSEMBL: ENSMUSP00000107873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112254]
AlphaFold no structure available at present
Predicted Effect not run
Transcript: ENSMUST00000001995
AA Change: D558G
SMART Domains Protein: ENSMUSP00000001995
Gene: ENSMUSG00000001930
AA Change: D558G

DomainStartEndE-ValueType
VWD 20 178 3.43e-35 SMART
C8 218 292 1.11e-21 SMART
Pfam:TIL 295 348 2.9e-14 PFAM
VWC 350 410 8.71e-1 SMART
VWD 377 540 2.93e-52 SMART
C8 577 649 3.82e-25 SMART
Pfam:TIL 652 707 5.7e-14 PFAM
EGF_like 787 822 4.37e1 SMART
VWC 829 898 3.29e-3 SMART
VWD 856 1012 5.15e-39 SMART
C8 1053 1127 1.01e-33 SMART
Pfam:TIL 1141 1196 3.6e-9 PFAM
VWA 1275 1458 1.81e-20 SMART
low complexity region 1461 1474 N/A INTRINSIC
VWA 1496 1669 8.43e-39 SMART
VWA 1689 1872 2.83e-31 SMART
VWC 1879 1946 2.99e0 SMART
VWD 1938 2101 5.03e-42 SMART
C8 2132 2200 1.29e-13 SMART
Pfam:TIL 2203 2254 1.2e-7 PFAM
VWC 2257 2325 3.16e-16 SMART
low complexity region 2414 2425 N/A INTRINSIC
VWC 2431 2494 2.61e-17 SMART
VWC 2510 2574 3.37e0 SMART
VWC 2582 2644 2.55e-11 SMART
CT 2727 2812 1.37e-31 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000107873
Gene: ENSMUSG00000001930
AA Change: D558G

DomainStartEndE-ValueType
VWD 23 181 3.43e-35 SMART
C8 221 295 1.11e-21 SMART
Pfam:TIL 298 351 6.9e-15 PFAM
VWC 353 413 8.71e-1 SMART
VWD 380 543 2.93e-52 SMART
C8 580 652 3.82e-25 SMART
Pfam:TIL 655 710 4.1e-14 PFAM
EGF_like 790 825 4.37e1 SMART
VWC 832 901 3.29e-3 SMART
VWD 859 1015 5.15e-39 SMART
C8 1056 1130 1.01e-33 SMART
Pfam:TIL 1144 1199 1.3e-9 PFAM
VWA 1278 1461 1.81e-20 SMART
low complexity region 1464 1477 N/A INTRINSIC
VWA 1499 1672 8.43e-39 SMART
VWA 1692 1875 2.83e-31 SMART
VWC 1882 1949 2.99e0 SMART
VWD 1941 2104 5.03e-42 SMART
C8 2135 2203 1.29e-13 SMART
Pfam:TIL 2206 2257 8.3e-8 PFAM
VWC 2260 2328 3.16e-16 SMART
low complexity region 2417 2428 N/A INTRINSIC
VWC 2434 2497 2.61e-17 SMART
VWC 2513 2577 3.37e0 SMART
VWC 2585 2647 2.55e-11 SMART
CT 2730 2815 1.37e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134073
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150548
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein involved in hemostasis. The encoded preproprotein is proteolytically processed following assembly into large multimeric complexes. These complexes function in the adhesion of platelets to sites of vascular injury and the transport of various proteins in the blood. Mutations in this gene result in von Willebrand disease, an inherited bleeding disorder. An unprocessed pseudogene has been found on chromosome 22. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous null mutants exhibit hemostatic and thrombotic defects similar to human von Willebrand disease. Mutants have prolonged bleeding time, newborns occasionally show fatal intra-abdominal bleeding and some adults have detectable fecal occult blood. [provided by MGI curators]
Allele List at MGI

All alleles(33) : Targeted, knock-out(1) Gene trapped(32)
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik G A 11: 78,284,129 A1697T probably benign Het
Ankar T C 1: 72,643,291 T1154A probably benign Het
Ankrd26 A T 6: 118,517,894 probably null Het
Arih2 A T 9: 108,607,973 *54R probably null Het
AW146154 T G 7: 41,480,297 K465T probably damaging Het
Bend3 A G 10: 43,510,544 Y311C probably benign Het
Ccdc110 A T 8: 45,943,499 Y809F possibly damaging Het
Ccnh C T 13: 85,190,863 P76L probably damaging Het
Chaf1a T A 17: 56,064,115 C667S probably damaging Het
Clca3a1 A T 3: 144,746,875 Y616N probably damaging Het
Cldn4 A G 5: 134,946,556 C64R probably damaging Het
Crybg2 TGGAGGAGGAGGAGGAGGAG TGGAGGAGGAGGAGGAG 4: 134,074,526 probably benign Het
Dclk2 C A 3: 86,787,225 R752L possibly damaging Het
Dzank1 C A 2: 144,501,489 G318W probably damaging Het
Edem1 T A 6: 108,842,962 I236K probably damaging Het
Eif4e1b T C 13: 54,784,822 F75L probably damaging Het
Elmo3 A G 8: 105,307,647 Y266C probably damaging Het
Enpep A G 3: 129,299,124 S509P probably damaging Het
Exoc8 A G 8: 124,896,653 M325T probably benign Het
Fah A G 7: 84,594,741 M270T probably benign Het
Gabbr1 T C 17: 37,067,862 L532P probably damaging Het
Gm10770 T A 2: 150,179,400 K66* probably null Het
Gprc5c A T 11: 114,864,487 Q330L possibly damaging Het
Grin3a T A 4: 49,792,602 H377L probably damaging Het
Hipk3 T C 2: 104,471,184 E221G probably damaging Het
Hsd17b6 T A 10: 127,991,439 M255L probably benign Het
Ighv1-7 T A 12: 114,538,759 E29D probably benign Het
Ing3 T A 6: 21,971,174 S326T probably benign Het
Ipo7 T C 7: 110,048,807 L632P probably damaging Het
Kdm6b A G 11: 69,403,788 probably null Het
Kif21a T G 15: 90,935,812 D1583A probably damaging Het
Lama2 C T 10: 27,190,676 V1070I probably benign Het
Lrp1 A T 10: 127,583,901 S946R probably damaging Het
Lrrc37a A G 11: 103,499,071 S1843P possibly damaging Het
Ltbp1 T C 17: 75,290,083 Y517H probably damaging Het
Map2k4 T A 11: 65,709,952 N51I probably benign Het
Mfsd2b G T 12: 4,866,522 A216D probably damaging Het
Nbea T C 3: 55,853,847 T2025A probably benign Het
Neb A G 2: 52,216,916 V4162A possibly damaging Het
Nr3c1 A T 18: 39,421,549 F599I probably damaging Het
Nsun2 T G 13: 69,623,152 probably null Het
Olfr479 T A 7: 108,055,798 M272K possibly damaging Het
Olfr884 G T 9: 38,047,701 V160F possibly damaging Het
Otoa T A 7: 121,127,713 W524R probably benign Het
Paip1 T A 13: 119,456,997 D182E probably damaging Het
Pde1a G A 2: 79,868,242 Q415* probably null Het
Pfkfb2 T A 1: 130,708,079 K72* probably null Het
Pigg A G 5: 108,332,191 E444G probably null Het
Plec T C 15: 76,189,037 Y669C probably damaging Het
Ptp4a3 T C 15: 73,756,036 V94A possibly damaging Het
Ptprg A G 14: 12,211,625 E969G probably damaging Het
R3hcc1l T A 19: 42,563,350 V262E probably benign Het
Ranbp3l T G 15: 9,002,093 F65C possibly damaging Het
Rbm19 T A 5: 120,140,307 S718R probably benign Het
Recql4 C A 15: 76,709,424 R162L probably benign Het
Rest T C 5: 77,268,272 L111P probably benign Het
Rgma T C 7: 73,409,468 S13P probably damaging Het
Rogdi T A 16: 5,013,311 I31F probably benign Het
Serpinb9e T A 13: 33,255,129 D179E probably benign Het
Slc1a5 T C 7: 16,795,882 C409R probably damaging Het
Slc25a38 A G 9: 120,116,547 T38A probably damaging Het
Spag17 C T 3: 100,095,791 Q1897* probably null Het
St7 C A 6: 17,694,222 A4E possibly damaging Het
Tbcel T A 9: 42,439,203 I263F possibly damaging Het
Tmtc3 A G 10: 100,476,672 V103A probably benign Het
Tnc G A 4: 64,018,166 P178S probably benign Het
Zfp541 A G 7: 16,076,419 K127R probably benign Het
Other mutations in Vwf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Vwf APN 6 125658872 missense unknown
IGL00561:Vwf APN 6 125642721 missense possibly damaging 0.88
IGL01104:Vwf APN 6 125683556 missense probably damaging 1.00
IGL01404:Vwf APN 6 125677970 missense probably damaging 1.00
IGL01539:Vwf APN 6 125590262 missense possibly damaging 0.85
IGL01550:Vwf APN 6 125679289 missense probably benign 0.00
IGL01563:Vwf APN 6 125591165 missense probably damaging 1.00
IGL01637:Vwf APN 6 125645736 missense probably damaging 1.00
IGL01720:Vwf APN 6 125642835 missense possibly damaging 0.69
IGL01834:Vwf APN 6 125590170 splice site probably benign
IGL02103:Vwf APN 6 125646355 missense probably damaging 1.00
IGL02120:Vwf APN 6 125616034 missense probably benign 0.26
IGL02174:Vwf APN 6 125555395 missense probably damaging 1.00
IGL02203:Vwf APN 6 125642406 missense probably damaging 1.00
IGL02420:Vwf APN 6 125677916 missense probably benign 0.00
IGL02723:Vwf APN 6 125642930 missense possibly damaging 0.85
IGL02818:Vwf APN 6 125663548 missense probably benign
IGL02931:Vwf APN 6 125615968 missense possibly damaging 0.68
IGL03015:Vwf APN 6 125684138 splice site probably benign
IGL03038:Vwf APN 6 125604157 missense possibly damaging 0.92
IGL03060:Vwf APN 6 125663560 missense probably damaging 1.00
IGL03114:Vwf APN 6 125599363 nonsense probably null
IGL03266:Vwf APN 6 125678077 splice site probably benign
gingerman UTSW 6 125662963 critical splice acceptor site probably null
R0605_vwf_644 UTSW 6 125685837 missense probably benign 0.02
R1575_Vwf_091 UTSW 6 125663571 nonsense probably null
R1628_Vwf_608 UTSW 6 125647738 unclassified probably benign
R1669_Vwf_448 UTSW 6 125647906 missense possibly damaging 0.92
R1833_Vwf_948 UTSW 6 125642037 missense probably benign 0.14
R2130_vwf_946 UTSW 6 125657057 missense probably damaging 1.00
R6360_Vwf_065 UTSW 6 125683526 missense probably benign 0.13
R7900_Vwf_938 UTSW 6 125628476 critical splice donor site probably null
Russiahouse UTSW 6 125639341 nonsense probably null
B5639:Vwf UTSW 6 125642984 missense probably damaging 1.00
R0025:Vwf UTSW 6 125682812 missense probably benign 0.05
R0025:Vwf UTSW 6 125682812 missense probably benign 0.05
R0087:Vwf UTSW 6 125645954 missense probably benign 0.03
R0194:Vwf UTSW 6 125643297 missense probably benign
R0206:Vwf UTSW 6 125637456 missense probably damaging 1.00
R0233:Vwf UTSW 6 125686510 missense possibly damaging 0.91
R0233:Vwf UTSW 6 125686510 missense possibly damaging 0.91
R0390:Vwf UTSW 6 125626361 nonsense probably null
R0427:Vwf UTSW 6 125673939 missense probably benign
R0437:Vwf UTSW 6 125566318 missense probably damaging 1.00
R0470:Vwf UTSW 6 125628428 missense possibly damaging 0.70
R0499:Vwf UTSW 6 125638114 missense probably benign 0.10
R0554:Vwf UTSW 6 125642781 missense probably benign 0.13
R0605:Vwf UTSW 6 125685837 missense probably benign 0.02
R0711:Vwf UTSW 6 125626271 missense probably benign 0.01
R0723:Vwf UTSW 6 125566262 missense probably benign 0.01
R0973:Vwf UTSW 6 125643006 missense probably damaging 1.00
R1054:Vwf UTSW 6 125590227 missense probably damaging 1.00
R1115:Vwf UTSW 6 125655065 missense unknown
R1156:Vwf UTSW 6 125637488 missense probably damaging 1.00
R1191:Vwf UTSW 6 125599252 missense probably damaging 1.00
R1240:Vwf UTSW 6 125603308 splice site probably null
R1398:Vwf UTSW 6 125603457 missense probably benign 0.02
R1435:Vwf UTSW 6 125642249 nonsense probably null
R1528:Vwf UTSW 6 125608291 missense possibly damaging 0.69
R1575:Vwf UTSW 6 125655251 missense unknown
R1575:Vwf UTSW 6 125663571 nonsense probably null
R1628:Vwf UTSW 6 125647738 unclassified probably benign
R1669:Vwf UTSW 6 125647906 missense possibly damaging 0.92
R1699:Vwf UTSW 6 125643069 missense probably damaging 1.00
R1699:Vwf UTSW 6 125685900 missense possibly damaging 0.74
R1725:Vwf UTSW 6 125646282 missense probably benign 0.05
R1742:Vwf UTSW 6 125667550 missense probably benign 0.02
R1809:Vwf UTSW 6 125590175 splice site probably benign
R1833:Vwf UTSW 6 125642037 missense probably benign 0.14
R1866:Vwf UTSW 6 125667529 missense possibly damaging 0.62
R1870:Vwf UTSW 6 125642939 missense probably damaging 1.00
R1874:Vwf UTSW 6 125628372 missense probably benign 0.00
R1941:Vwf UTSW 6 125639279 missense possibly damaging 0.64
R2061:Vwf UTSW 6 125591188 missense probably damaging 0.98
R2103:Vwf UTSW 6 125646330 missense probably benign 0.31
R2104:Vwf UTSW 6 125646330 missense probably benign 0.31
R2130:Vwf UTSW 6 125657057 missense probably damaging 1.00
R2159:Vwf UTSW 6 125626341 missense probably damaging 0.99
R2178:Vwf UTSW 6 125642132 missense possibly damaging 0.90
R2656:Vwf UTSW 6 125555361 missense probably benign 0.00
R2913:Vwf UTSW 6 125685846 missense probably benign 0.08
R2917:Vwf UTSW 6 125608143 missense probably benign 0.07
R3726:Vwf UTSW 6 125677948 utr 3 prime probably benign
R3735:Vwf UTSW 6 125588613 missense probably damaging 1.00
R3774:Vwf UTSW 6 125649099 splice site probably null
R3934:Vwf UTSW 6 125555499 missense probably damaging 1.00
R4291:Vwf UTSW 6 125642322 missense probably damaging 1.00
R4384:Vwf UTSW 6 125655116 missense unknown
R4743:Vwf UTSW 6 125684091 critical splice acceptor site probably null
R4760:Vwf UTSW 6 125570604 missense probably damaging 1.00
R4776:Vwf UTSW 6 125566305 missense possibly damaging 0.53
R4791:Vwf UTSW 6 125643363 missense
R4871:Vwf UTSW 6 125686462 missense probably benign 0.25
R4894:Vwf UTSW 6 125645934 nonsense probably null
R4963:Vwf UTSW 6 125667483 nonsense probably null
R5010:Vwf UTSW 6 125566257 missense probably benign 0.15
R5289:Vwf UTSW 6 125667510 utr 3 prime probably benign
R5512:Vwf UTSW 6 125673887 utr 3 prime probably benign
R5523:Vwf UTSW 6 125643042 missense
R5642:Vwf UTSW 6 125603418 missense
R5860:Vwf UTSW 6 125643090 missense
R5860:Vwf UTSW 6 125679265 utr 3 prime probably benign
R5896:Vwf UTSW 6 125678762 critical splice acceptor site probably null
R5926:Vwf UTSW 6 125604174 missense probably damaging 1.00
R6053:Vwf UTSW 6 125600665 missense probably benign 0.21
R6151:Vwf UTSW 6 125657065 missense unknown
R6179:Vwf UTSW 6 125649289 missense unknown
R6181:Vwf UTSW 6 125566146 missense probably damaging 0.98
R6234:Vwf UTSW 6 125657165 missense unknown
R6360:Vwf UTSW 6 125683526 missense probably benign 0.13
R6412:Vwf UTSW 6 125679316 missense probably benign 0.00
R6464:Vwf UTSW 6 125639400 critical splice donor site probably null
R6522:Vwf UTSW 6 125662963 critical splice acceptor site probably null
R6766:Vwf UTSW 6 125639376 missense unknown
R6856:Vwf UTSW 6 125642150 nonsense probably null
R6877:Vwf UTSW 6 125657201 missense possibly damaging 0.48
R6896:Vwf UTSW 6 125566194 missense probably damaging 1.00
R7113:Vwf UTSW 6 125655044 missense
R7287:Vwf UTSW 6 125637467 missense
R7359:Vwf UTSW 6 125566257 missense
R7509:Vwf UTSW 6 125642169 missense
R7519:Vwf UTSW 6 125667543 missense
R7545:Vwf UTSW 6 125614097 missense
R7549:Vwf UTSW 6 125626267 missense
R7593:Vwf UTSW 6 125647768 missense
R7635:Vwf UTSW 6 125682734 missense
R7793:Vwf UTSW 6 125686520 missense
R7802:Vwf UTSW 6 125666677 missense
R7824:Vwf UTSW 6 125658815 missense
R7849:Vwf UTSW 6 125656803 missense
R7900:Vwf UTSW 6 125628476 critical splice donor site probably null
R7919:Vwf UTSW 6 125647859 missense
R7966:Vwf UTSW 6 125639341 nonsense probably null
R8101:Vwf UTSW 6 125570559 nonsense probably null
R8162:Vwf UTSW 6 125645836 splice site probably null
R8345:Vwf UTSW 6 125679302 missense
R8853:Vwf UTSW 6 125657264 missense
R9027:Vwf UTSW 6 125666663 missense
R9065:Vwf UTSW 6 125646299 missense
R9068:Vwf UTSW 6 125648829 unclassified probably benign
R9128:Vwf UTSW 6 125642730 missense
R9136:Vwf UTSW 6 125599393 splice site probably benign
R9164:Vwf UTSW 6 125565843 missense
R9177:Vwf UTSW 6 125604291 missense
R9334:Vwf UTSW 6 125677946 missense
R9508:Vwf UTSW 6 125555508 missense
R9553:Vwf UTSW 6 125600699 missense
R9660:Vwf UTSW 6 125591707 missense possibly damaging 0.61
R9706:Vwf UTSW 6 125624573 missense
R9708:Vwf UTSW 6 125657090 missense
R9712:Vwf UTSW 6 125624573 missense
R9714:Vwf UTSW 6 125624573 missense
R9728:Vwf UTSW 6 125591707 missense possibly damaging 0.61
R9758:Vwf UTSW 6 125626267 missense
X0021:Vwf UTSW 6 125646331 missense probably damaging 1.00
X0065:Vwf UTSW 6 125603433 missense probably null 0.05
Z1176:Vwf UTSW 6 125591231 missense
Z1176:Vwf UTSW 6 125603308 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGTGGAACCATTGTGGCACTG -3'
(R):5'- CATGGATGGAGGGTGTTCAATAAAC -3'

Sequencing Primer
(F):5'- CATTGTGGCACTGGGGGAC -3'
(R):5'- AATGTGGATCTCAACGGCC -3'
Posted On 2017-03-31