Incidental Mutation 'R5976:Olfr479'
ID471768
Institutional Source Beutler Lab
Gene Symbol Olfr479
Ensembl Gene ENSMUSG00000043855
Gene Nameolfactory receptor 479
SynonymsMOR267-15, GA_x6K02T2PBJ9-10384085-10385068
MMRRC Submission 044158-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R5976 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location108050693-108056783 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108055798 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 272 (M272K)
Ref Sequence ENSEMBL: ENSMUSP00000149060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063151] [ENSMUST00000209805] [ENSMUST00000214599]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063151
AA Change: M272K

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000056631
Gene: ENSMUSG00000043855
AA Change: M272K

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 7.5e-45 PFAM
Pfam:7tm_1 39 301 1.9e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000209805
AA Change: M272K

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214599
AA Change: M272K

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik G A 11: 78,284,129 A1697T probably benign Het
Ankar T C 1: 72,643,291 T1154A probably benign Het
Ankrd26 A T 6: 118,517,894 probably null Het
Arih2 A T 9: 108,607,973 *54R probably null Het
AW146154 T G 7: 41,480,297 K465T probably damaging Het
Bend3 A G 10: 43,510,544 Y311C probably benign Het
Ccdc110 A T 8: 45,943,499 Y809F possibly damaging Het
Ccnh C T 13: 85,190,863 P76L probably damaging Het
Chaf1a T A 17: 56,064,115 C667S probably damaging Het
Clca3a1 A T 3: 144,746,875 Y616N probably damaging Het
Cldn4 A G 5: 134,946,556 C64R probably damaging Het
Crybg2 TGGAGGAGGAGGAGGAGGAG TGGAGGAGGAGGAGGAG 4: 134,074,526 probably benign Het
Dclk2 C A 3: 86,787,225 R752L possibly damaging Het
Dzank1 C A 2: 144,501,489 G318W probably damaging Het
Edem1 T A 6: 108,842,962 I236K probably damaging Het
Eif4e1b T C 13: 54,784,822 F75L probably damaging Het
Elmo3 A G 8: 105,307,647 Y266C probably damaging Het
Enpep A G 3: 129,299,124 S509P probably damaging Het
Exoc8 A G 8: 124,896,653 M325T probably benign Het
Fah A G 7: 84,594,741 M270T probably benign Het
Gabbr1 T C 17: 37,067,862 L532P probably damaging Het
Gm10770 T A 2: 150,179,400 K66* probably null Het
Gprc5c A T 11: 114,864,487 Q330L possibly damaging Het
Grin3a T A 4: 49,792,602 H377L probably damaging Het
Hipk3 T C 2: 104,471,184 E221G probably damaging Het
Hsd17b6 T A 10: 127,991,439 M255L probably benign Het
Ighv1-7 T A 12: 114,538,759 E29D probably benign Het
Ing3 T A 6: 21,971,174 S326T probably benign Het
Ipo7 T C 7: 110,048,807 L632P probably damaging Het
Kdm6b A G 11: 69,403,788 probably null Het
Kif21a T G 15: 90,935,812 D1583A probably damaging Het
Lama2 C T 10: 27,190,676 V1070I probably benign Het
Lrp1 A T 10: 127,583,901 S946R probably damaging Het
Lrrc37a A G 11: 103,499,071 S1843P possibly damaging Het
Ltbp1 T C 17: 75,290,083 Y517H probably damaging Het
Map2k4 T A 11: 65,709,952 N51I probably benign Het
Mfsd2b G T 12: 4,866,522 A216D probably damaging Het
Nbea T C 3: 55,853,847 T2025A probably benign Het
Neb A G 2: 52,216,916 V4162A possibly damaging Het
Nr3c1 A T 18: 39,421,549 F599I probably damaging Het
Nsun2 T G 13: 69,623,152 probably null Het
Olfr884 G T 9: 38,047,701 V160F possibly damaging Het
Otoa T A 7: 121,127,713 W524R probably benign Het
Paip1 T A 13: 119,456,997 D182E probably damaging Het
Pde1a G A 2: 79,868,242 Q415* probably null Het
Pfkfb2 T A 1: 130,708,079 K72* probably null Het
Pigg A G 5: 108,332,191 E444G probably null Het
Plec T C 15: 76,189,037 Y669C probably damaging Het
Ptp4a3 T C 15: 73,756,036 V94A possibly damaging Het
Ptprg A G 14: 12,211,625 E969G probably damaging Het
R3hcc1l T A 19: 42,563,350 V262E probably benign Het
Ranbp3l T G 15: 9,002,093 F65C possibly damaging Het
Rbm19 T A 5: 120,140,307 S718R probably benign Het
Recql4 C A 15: 76,709,424 R162L probably benign Het
Rest T C 5: 77,268,272 L111P probably benign Het
Rgma T C 7: 73,409,468 S13P probably damaging Het
Rogdi T A 16: 5,013,311 I31F probably benign Het
Serpinb9e T A 13: 33,255,129 D179E probably benign Het
Slc1a5 T C 7: 16,795,882 C409R probably damaging Het
Slc25a38 A G 9: 120,116,547 T38A probably damaging Het
Spag17 C T 3: 100,095,791 Q1897* probably null Het
St7 C A 6: 17,694,222 A4E possibly damaging Het
Tbcel T A 9: 42,439,203 I263F possibly damaging Het
Tmtc3 A G 10: 100,476,672 V103A probably benign Het
Tnc G A 4: 64,018,166 P178S probably benign Het
Vwf A G 6: 125,603,463 D558G Het
Zfp541 A G 7: 16,076,419 K127R probably benign Het
Other mutations in Olfr479
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Olfr479 APN 7 108055567 missense probably damaging 0.96
IGL01320:Olfr479 APN 7 108054981 utr 5 prime probably benign
IGL01322:Olfr479 APN 7 108054981 utr 5 prime probably benign
R0396:Olfr479 UTSW 7 108055963 missense probably benign 0.11
R0539:Olfr479 UTSW 7 108055822 missense probably damaging 1.00
R2129:Olfr479 UTSW 7 108055904 missense probably benign 0.25
R2246:Olfr479 UTSW 7 108055782 missense probably benign 0.00
R2247:Olfr479 UTSW 7 108055782 missense probably benign 0.00
R3149:Olfr479 UTSW 7 108055782 missense probably benign 0.00
R3709:Olfr479 UTSW 7 108055797 missense possibly damaging 0.63
R3714:Olfr479 UTSW 7 108055435 missense probably damaging 0.99
R4326:Olfr479 UTSW 7 108055155 missense probably damaging 1.00
R4962:Olfr479 UTSW 7 108055440 missense probably benign 0.27
R5053:Olfr479 UTSW 7 108055534 missense probably benign 0.10
R6151:Olfr479 UTSW 7 108055899 missense probably benign
R6939:Olfr479 UTSW 7 108055105 missense possibly damaging 0.87
R7271:Olfr479 UTSW 7 108055216 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTGTGATTACACTGCTCATC -3'
(R):5'- AATTTCCCACTATTGTTGTCAGTGC -3'

Sequencing Primer
(F):5'- GCAGCTTTGTTTTAATCATGATTTCC -3'
(R):5'- CCACTATTGTTGTCAGTGCTCAATAG -3'
Posted On2017-03-31