Mutagenetix > Incidental Mutations

Incidental Mutation 'R5976:Gprc5c'

471787

Institutional Source

Beutler Lab

Gene Symbol

Gprc5c

Ensembl Gene

ENSMUSG00000051043

Gene Name

G protein-coupled receptor, family C, group 5, member C

Synonyms

MMRRC Submission

044158-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.302) question?

Stock #

R5976 (G1)

Quality Score

159

Status

Not validated

Chromosome

Chromosomal Location

114851152-114872617 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 114864487 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 330 (Q330L)

Ref Sequence

ENSEMBL: ENSMUSP00000061760 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021071] [ENSMUST00000053361] [ENSMUST00000122967] [ENSMUST00000133245] [ENSMUST00000136785] [ENSMUST00000142262] [ENSMUST00000152314] [ENSMUST00000177952]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000021071
AA Change: Q330L

PolyPhen 2 Score 0.680 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000021071
Gene: ENSMUSG00000051043
AA Change: Q330L

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:7tm_3	58	302	1.3e-42	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000053361
AA Change: Q330L

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000061760
Gene: ENSMUSG00000051043
AA Change: Q330L

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:7tm_3	60	301	1.3e-28	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000122967

SMART Domains

Protein: ENSMUSP00000114335
Gene: ENSMUSG00000051043

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
transmembrane domain	55	77	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000133245

SMART Domains

Protein: ENSMUSP00000121572
Gene: ENSMUSG00000051043

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
transmembrane domain	55	77	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000136785

SMART Domains

Protein: ENSMUSP00000116786
Gene: ENSMUSG00000051043

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:7tm_3	58	283	1.5e-38	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000142262

SMART Domains

Protein: ENSMUSP00000121524
Gene: ENSMUSG00000051043

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:7tm_3	58	133	6.2e-14	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000152314

Predicted Effect

possibly damaging
Transcript: ENSMUST00000177952
AA Change: Q330L

PolyPhen 2 Score 0.680 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000136702
Gene: ENSMUSG00000051043
AA Change: Q330L

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:7tm_3	58	302	1.3e-42	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the type 3 G protein-coupled receptor family. Members of this superfamily are characterized by a signature 7-transmembrane domain motif. The specific function of this protein is unknown; however, this protein may mediate the cellular effects of retinoic acid on the G protein signal transduction cascade. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter allele are behaviorally normal but exhibit reticulocytosis, increased mean corpuscular volume, increased percentage of basophils, decreased mean corpuscular hemogloblin concentration, and increased alkaline phophatase and lactic dehydrogenase levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	G	A	11: 78,284,129	A1697T	probably benign	Het
Ankar	T	C	1: 72,643,291	T1154A	probably benign	Het
Ankrd26	A	T	6: 118,517,894		probably null	Het
Arih2	A	T	9: 108,607,973	*54R	probably null	Het
AW146154	T	G	7: 41,480,297	K465T	probably damaging	Het
Bend3	A	G	10: 43,510,544	Y311C	probably benign	Het
Ccdc110	A	T	8: 45,943,499	Y809F	possibly damaging	Het
Ccnh	C	T	13: 85,190,863	P76L	probably damaging	Het
Chaf1a	T	A	17: 56,064,115	C667S	probably damaging	Het
Clca3a1	A	T	3: 144,746,875	Y616N	probably damaging	Het
Cldn4	A	G	5: 134,946,556	C64R	probably damaging	Het
Crybg2	TGGAGGAGGAGGAGGAGGAG	TGGAGGAGGAGGAGGAG	4: 134,074,526		probably benign	Het
Dclk2	C	A	3: 86,787,225	R752L	possibly damaging	Het
Dzank1	C	A	2: 144,501,489	G318W	probably damaging	Het
Edem1	T	A	6: 108,842,962	I236K	probably damaging	Het
Eif4e1b	T	C	13: 54,784,822	F75L	probably damaging	Het
Elmo3	A	G	8: 105,307,647	Y266C	probably damaging	Het
Enpep	A	G	3: 129,299,124	S509P	probably damaging	Het
Exoc8	A	G	8: 124,896,653	M325T	probably benign	Het
Fah	A	G	7: 84,594,741	M270T	probably benign	Het
Gabbr1	T	C	17: 37,067,862	L532P	probably damaging	Het
Gm10770	T	A	2: 150,179,400	K66*	probably null	Het
Grin3a	T	A	4: 49,792,602	H377L	probably damaging	Het
Hipk3	T	C	2: 104,471,184	E221G	probably damaging	Het
Hsd17b6	T	A	10: 127,991,439	M255L	probably benign	Het
Ighv1-7	T	A	12: 114,538,759	E29D	probably benign	Het
Ing3	T	A	6: 21,971,174	S326T	probably benign	Het
Ipo7	T	C	7: 110,048,807	L632P	probably damaging	Het
Kdm6b	A	G	11: 69,403,788		probably null	Het
Kif21a	T	G	15: 90,935,812	D1583A	probably damaging	Het
Lama2	C	T	10: 27,190,676	V1070I	probably benign	Het
Lrp1	A	T	10: 127,583,901	S946R	probably damaging	Het
Lrrc37a	A	G	11: 103,499,071	S1843P	possibly damaging	Het
Ltbp1	T	C	17: 75,290,083	Y517H	probably damaging	Het
Map2k4	T	A	11: 65,709,952	N51I	probably benign	Het
Mfsd2b	G	T	12: 4,866,522	A216D	probably damaging	Het
Nbea	T	C	3: 55,853,847	T2025A	probably benign	Het
Neb	A	G	2: 52,216,916	V4162A	possibly damaging	Het
Nr3c1	A	T	18: 39,421,549	F599I	probably damaging	Het
Nsun2	T	G	13: 69,623,152		probably null	Het
Olfr479	T	A	7: 108,055,798	M272K	possibly damaging	Het
Olfr884	G	T	9: 38,047,701	V160F	possibly damaging	Het
Otoa	T	A	7: 121,127,713	W524R	probably benign	Het
Paip1	T	A	13: 119,456,997	D182E	probably damaging	Het
Pde1a	G	A	2: 79,868,242	Q415*	probably null	Het
Pfkfb2	T	A	1: 130,708,079	K72*	probably null	Het
Pigg	A	G	5: 108,332,191	E444G	probably null	Het
Plec	T	C	15: 76,189,037	Y669C	probably damaging	Het
Ptp4a3	T	C	15: 73,756,036	V94A	possibly damaging	Het
Ptprg	A	G	14: 12,211,625	E969G	probably damaging	Het
R3hcc1l	T	A	19: 42,563,350	V262E	probably benign	Het
Ranbp3l	T	G	15: 9,002,093	F65C	possibly damaging	Het
Rbm19	T	A	5: 120,140,307	S718R	probably benign	Het
Recql4	C	A	15: 76,709,424	R162L	probably benign	Het
Rest	T	C	5: 77,268,272	L111P	probably benign	Het
Rgma	T	C	7: 73,409,468	S13P	probably damaging	Het
Rogdi	T	A	16: 5,013,311	I31F	probably benign	Het
Serpinb9e	T	A	13: 33,255,129	D179E	probably benign	Het
Slc1a5	T	C	7: 16,795,882	C409R	probably damaging	Het
Slc25a38	A	G	9: 120,116,547	T38A	probably damaging	Het
Spag17	C	T	3: 100,095,791	Q1897*	probably null	Het
St7	C	A	6: 17,694,222	A4E	possibly damaging	Het
Tbcel	T	A	9: 42,439,203	I263F	possibly damaging	Het
Tmtc3	A	G	10: 100,476,672	V103A	probably benign	Het
Tnc	G	A	4: 64,018,166	P178S	probably benign	Het
Vwf	A	G	6: 125,603,463	D558G		Het
Zfp541	A	G	7: 16,076,419	K127R	probably benign	Het

Other mutations in Gprc5c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01599:Gprc5c	APN	11	114864252	missense	probably benign	0.01
IGL01762:Gprc5c	APN	11	114864024	missense	probably benign	0.28
IGL02039:Gprc5c	APN	11	114864486	nonsense	probably null
R0800:Gprc5c	UTSW	11	114866711	missense	probably damaging	0.99
R1618:Gprc5c	UTSW	11	114864394	missense	possibly damaging	0.88
R4198:Gprc5c	UTSW	11	114863860	missense	probably damaging	1.00
R4807:Gprc5c	UTSW	11	114864498	missense	probably damaging	0.97
R4846:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R4902:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R4904:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5016:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5048:Gprc5c	UTSW	11	114870351	makesense	probably null
R5106:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5109:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5173:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5266:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5267:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5475:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5508:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5557:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5562:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5563:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5598:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5599:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5729:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5756:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5792:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5793:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5794:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5817:Gprc5c	UTSW	11	114863624	nonsense	probably null
R6151:Gprc5c	UTSW	11	114864025	missense	probably damaging	1.00
R6617:Gprc5c	UTSW	11	114864105	missense	probably benign	0.05
R7108:Gprc5c	UTSW	11	114864282	missense	probably damaging	1.00
R7191:Gprc5c	UTSW	11	114868617	missense	possibly damaging	0.56
R7796:Gprc5c	UTSW	11	114864532	missense	probably damaging	0.97
R8543:Gprc5c	UTSW	11	114864268	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGATGACCCCACGTTGGC -3'
(R):5'- GGATGAAAATCAGCAACAGCC -3'

Sequencing Primer
(F):5'- ACCCCACGTTGGCCATTG -3'
(R):5'- ACAGATTTGAGTTCCAGGCC -3'

Posted On

2017-03-31