Incidental Mutation 'R5961:Cfap57'
ID 471820
Institutional Source Beutler Lab
Gene Symbol Cfap57
Ensembl Gene ENSMUSG00000028730
Gene Name cilia and flagella associated protein 57
Synonyms Wdr65, 1110020C03Rik, C130004B06Rik, LOC384050
MMRRC Submission 043247-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5961 (G1)
Quality Score 133
Status Not validated
Chromosome 4
Chromosomal Location 118554551-118620777 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 118571745 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1008 (E1008G)
Ref Sequence ENSEMBL: ENSMUSP00000080592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071972] [ENSMUST00000081921]
AlphaFold Q9D180
Predicted Effect probably benign
Transcript: ENSMUST00000071972
AA Change: E1008G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000071863
Gene: ENSMUSG00000028730
AA Change: E1008G

DomainStartEndE-ValueType
Blast:WD40 44 88 3e-12 BLAST
Blast:WD40 95 137 1e-9 BLAST
WD40 140 181 1.77e2 SMART
internal_repeat_1 182 237 7.23e-5 PROSPERO
WD40 329 365 1.27e2 SMART
WD40 376 416 3.4e-2 SMART
WD40 418 456 1.59e1 SMART
Blast:WD40 461 497 4e-18 BLAST
WD40 500 539 9.67e-7 SMART
WD40 544 581 3.96e1 SMART
Blast:WD40 582 621 8e-16 BLAST
WD40 626 665 3.21e-1 SMART
coiled coil region 690 1056 N/A INTRINSIC
coiled coil region 1094 1166 N/A INTRINSIC
coiled coil region 1197 1222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081921
AA Change: E1008G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000080592
Gene: ENSMUSG00000028730
AA Change: E1008G

DomainStartEndE-ValueType
Blast:WD40 44 88 3e-12 BLAST
Blast:WD40 95 137 1e-9 BLAST
WD40 140 181 1.77e2 SMART
internal_repeat_1 182 237 7.23e-5 PROSPERO
WD40 329 365 1.27e2 SMART
WD40 376 416 3.4e-2 SMART
WD40 418 456 1.59e1 SMART
Blast:WD40 461 497 4e-18 BLAST
WD40 500 539 9.67e-7 SMART
WD40 544 581 3.96e1 SMART
Blast:WD40 582 621 8e-16 BLAST
WD40 626 665 3.21e-1 SMART
coiled coil region 690 1056 N/A INTRINSIC
coiled coil region 1094 1166 N/A INTRINSIC
coiled coil region 1197 1222 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein encoded by this gene belongs to the WD repeat-containing family of proteins, which function in the formation of protein-protein complexes in a variety of biological pathways. This family member is thought to function in craniofacial development, possibly in the fusion of lip and palate. A missense mutation in this gene is associated with Van der Woude syndrome 2. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810022K09Rik T C 3: 14,611,064 T26A possibly damaging Het
Ackr4 A G 9: 104,099,139 L203P probably damaging Het
Aen C G 7: 78,907,159 H252D probably damaging Het
Alkbh6 T A 7: 30,314,192 probably null Het
Birc6 T C 17: 74,646,601 V3286A probably damaging Het
Cacna1h A G 17: 25,377,272 M1925T probably benign Het
Caprin2 A C 6: 148,863,540 S554R probably damaging Het
Celsr3 T C 9: 108,831,794 S1280P probably damaging Het
Csmd1 A G 8: 16,070,352 I1813T probably damaging Het
Dnah10 A G 5: 124,811,482 E3050G probably benign Het
Dnah2 A G 11: 69,431,148 F3782S probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dnajc17 T C 2: 119,186,046 T64A possibly damaging Het
Dvl3 T G 16: 20,530,979 S567R possibly damaging Het
Epb41l1 T A 2: 156,521,786 S738R probably benign Het
Exph5 T C 9: 53,377,255 W1879R probably damaging Het
Fam83a T A 15: 58,009,596 F274I possibly damaging Het
Ggt1 A G 10: 75,585,902 probably null Het
Ido2 C T 8: 24,533,770 V351M probably damaging Het
Kcnt2 A G 1: 140,507,702 E469G possibly damaging Het
Kdm2b A G 5: 122,932,661 S403P probably benign Het
Klhl2 C T 8: 64,749,784 R460H probably damaging Het
Mfsd6l A G 11: 68,556,542 Y73C possibly damaging Het
Mlec A T 5: 115,150,100 C205* probably null Het
Mlx T C 11: 101,089,227 Y129H probably damaging Het
Mmadhc T C 2: 50,291,409 H83R probably damaging Het
Mmp16 T C 4: 17,853,842 F41S probably benign Het
Mroh6 G A 15: 75,887,768 Q187* probably null Het
Myh14 T A 7: 44,623,094 E1437V probably damaging Het
Nrxn1 A C 17: 90,454,943 L37R probably damaging Het
Olfr799 T C 10: 129,647,854 M242T possibly damaging Het
Pkhd1l1 A C 15: 44,459,463 R48S probably damaging Het
Prokr2 A G 2: 132,373,675 Y128H possibly damaging Het
Prtg T C 9: 72,856,946 V567A probably benign Het
Srrm2 G A 17: 23,820,109 probably benign Het
Stat4 A T 1: 52,065,384 I115L possibly damaging Het
Tnxb G A 17: 34,718,635 V3833M probably damaging Het
Ugt2b36 C T 5: 87,080,865 probably null Het
Usp45 A C 4: 21,810,797 D331A probably damaging Het
Usp47 T C 7: 112,053,316 S47P probably damaging Het
Vps53 A G 11: 76,048,490 Y696H probably damaging Het
Zfp384 T C 6: 125,024,034 I23T probably damaging Het
Zfp804a A G 2: 82,258,002 Y725C probably benign Het
Other mutations in Cfap57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Cfap57 APN 4 118581001 missense probably benign 0.01
IGL00508:Cfap57 APN 4 118581170 splice site probably null
IGL00857:Cfap57 APN 4 118612923 critical splice donor site probably null
IGL01147:Cfap57 APN 4 118589001 missense probably damaging 0.97
IGL01396:Cfap57 APN 4 118610595 missense probably damaging 1.00
IGL01420:Cfap57 APN 4 118612940 missense probably benign 0.21
IGL01615:Cfap57 APN 4 118600796 missense probably damaging 1.00
IGL02154:Cfap57 APN 4 118613017 missense probably damaging 1.00
IGL02161:Cfap57 APN 4 118579372 missense possibly damaging 0.75
IGL02481:Cfap57 APN 4 118581105 missense probably damaging 1.00
IGL02483:Cfap57 APN 4 118581105 missense probably damaging 1.00
IGL02503:Cfap57 APN 4 118569348 critical splice donor site probably null
IGL02800:Cfap57 APN 4 118614750 missense probably damaging 1.00
IGL03083:Cfap57 APN 4 118584739 missense probably damaging 0.96
IGL03146:Cfap57 APN 4 118599019 missense probably damaging 1.00
IGL03246:Cfap57 APN 4 118576645 missense probably benign 0.29
IGL03376:Cfap57 APN 4 118584720 missense probably damaging 0.96
G1Funyon:Cfap57 UTSW 4 118593074 missense possibly damaging 0.94
R0144:Cfap57 UTSW 4 118584705 missense probably damaging 1.00
R0184:Cfap57 UTSW 4 118599012 missense probably damaging 1.00
R0415:Cfap57 UTSW 4 118569431 missense possibly damaging 0.89
R0515:Cfap57 UTSW 4 118620402 missense probably damaging 1.00
R0690:Cfap57 UTSW 4 118569727 splice site probably benign
R0730:Cfap57 UTSW 4 118612920 splice site probably null
R0737:Cfap57 UTSW 4 118581102 missense possibly damaging 0.81
R0854:Cfap57 UTSW 4 118561872 missense probably benign 0.04
R0880:Cfap57 UTSW 4 118581838 nonsense probably null
R1085:Cfap57 UTSW 4 118595779 missense probably benign 0.20
R1119:Cfap57 UTSW 4 118606676 nonsense probably null
R1217:Cfap57 UTSW 4 118606652 missense possibly damaging 0.67
R1294:Cfap57 UTSW 4 118606534 critical splice donor site probably null
R1487:Cfap57 UTSW 4 118614781 missense probably benign 0.01
R1676:Cfap57 UTSW 4 118595940 missense probably damaging 1.00
R1688:Cfap57 UTSW 4 118569646 missense probably null 0.20
R1709:Cfap57 UTSW 4 118571704 missense probably benign 0.00
R1719:Cfap57 UTSW 4 118606631 missense probably benign 0.04
R1782:Cfap57 UTSW 4 118614975 missense probably damaging 0.98
R1791:Cfap57 UTSW 4 118571724 missense possibly damaging 0.66
R1850:Cfap57 UTSW 4 118599894 missense probably damaging 1.00
R1866:Cfap57 UTSW 4 118599927 missense possibly damaging 0.49
R1912:Cfap57 UTSW 4 118615010 missense probably damaging 0.96
R1978:Cfap57 UTSW 4 118593132 missense probably benign 0.03
R2177:Cfap57 UTSW 4 118606688 missense probably benign 0.00
R2322:Cfap57 UTSW 4 118610725 missense probably benign
R3905:Cfap57 UTSW 4 118595839 missense probably damaging 1.00
R4013:Cfap57 UTSW 4 118593143 missense probably benign 0.01
R4079:Cfap57 UTSW 4 118598997 missense probably benign 0.34
R4962:Cfap57 UTSW 4 118613065 missense probably benign 0.21
R4970:Cfap57 UTSW 4 118620371 missense probably damaging 0.99
R4974:Cfap57 UTSW 4 118593054 missense probably damaging 1.00
R4999:Cfap57 UTSW 4 118595848 missense probably benign 0.01
R5482:Cfap57 UTSW 4 118569641 missense probably benign
R5522:Cfap57 UTSW 4 118595888 missense probably benign 0.41
R5626:Cfap57 UTSW 4 118614783 missense probably damaging 1.00
R5685:Cfap57 UTSW 4 118569459 missense probably benign
R5712:Cfap57 UTSW 4 118614795 missense probably damaging 1.00
R6244:Cfap57 UTSW 4 118579410 missense probably damaging 0.99
R6268:Cfap57 UTSW 4 118569451 nonsense probably null
R6271:Cfap57 UTSW 4 118595759 missense probably benign 0.13
R6330:Cfap57 UTSW 4 118569396 missense probably benign
R6439:Cfap57 UTSW 4 118588975 critical splice donor site probably null
R6639:Cfap57 UTSW 4 118554712 missense probably benign 0.13
R6722:Cfap57 UTSW 4 118584717 missense probably damaging 1.00
R7033:Cfap57 UTSW 4 118613126 missense possibly damaging 0.67
R7143:Cfap57 UTSW 4 118620709 unclassified probably benign
R7162:Cfap57 UTSW 4 118614931 missense probably benign
R7174:Cfap57 UTSW 4 118589067 missense probably benign 0.35
R7210:Cfap57 UTSW 4 118576703 nonsense probably null
R7242:Cfap57 UTSW 4 118593096 missense possibly damaging 0.50
R7244:Cfap57 UTSW 4 118554800 nonsense probably null
R7359:Cfap57 UTSW 4 118598965 missense probably benign 0.01
R7373:Cfap57 UTSW 4 118614931 missense probably benign
R7394:Cfap57 UTSW 4 118593137 missense probably benign 0.00
R7401:Cfap57 UTSW 4 118614931 missense probably benign
R7412:Cfap57 UTSW 4 118614931 missense probably benign
R7414:Cfap57 UTSW 4 118614931 missense probably benign
R7452:Cfap57 UTSW 4 118595784 missense probably damaging 1.00
R7457:Cfap57 UTSW 4 118589001 missense probably damaging 0.97
R7559:Cfap57 UTSW 4 118614931 missense probably benign
R7642:Cfap57 UTSW 4 118614931 missense probably benign
R7741:Cfap57 UTSW 4 118614931 missense probably benign
R7744:Cfap57 UTSW 4 118614931 missense probably benign
R7745:Cfap57 UTSW 4 118614931 missense probably benign
R7842:Cfap57 UTSW 4 118554755 nonsense probably null
R7936:Cfap57 UTSW 4 118614931 missense probably benign
R7940:Cfap57 UTSW 4 118614931 missense probably benign
R7942:Cfap57 UTSW 4 118614931 missense probably benign
R8074:Cfap57 UTSW 4 118569625 missense possibly damaging 0.66
R8301:Cfap57 UTSW 4 118593074 missense possibly damaging 0.94
R8411:Cfap57 UTSW 4 118614931 missense probably benign
R8447:Cfap57 UTSW 4 118614931 missense probably benign
R8491:Cfap57 UTSW 4 118614931 missense probably benign
R8524:Cfap57 UTSW 4 118614931 missense probably benign
R8670:Cfap57 UTSW 4 118614925 missense possibly damaging 0.91
R8707:Cfap57 UTSW 4 118593006 missense probably benign 0.04
R8790:Cfap57 UTSW 4 118581914 missense possibly damaging 0.59
R8941:Cfap57 UTSW 4 118569602 missense probably damaging 0.99
R9139:Cfap57 UTSW 4 118554851 missense probably benign 0.02
R9212:Cfap57 UTSW 4 118579452 missense possibly damaging 0.95
X0022:Cfap57 UTSW 4 118614745 missense probably benign
Z1088:Cfap57 UTSW 4 118581882 missense probably benign 0.22
Z1177:Cfap57 UTSW 4 118598956 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGAAGTGTTTCTTAGCAATGGC -3'
(R):5'- AGAAGAAAACTCTGTGACCTGGC -3'

Sequencing Primer
(F):5'- CAATGGCTGGCTCTGTCTCG -3'
(R):5'- CACAGACAGGTGCAGGACTC -3'
Posted On 2017-03-31