Incidental Mutation 'R5963:Slc9a2'
ID471857
Institutional Source Beutler Lab
Gene Symbol Slc9a2
Ensembl Gene ENSMUSG00000026062
Gene Namesolute carrier family 9 (sodium/hydrogen exchanger), member 2
Synonyms2210416H12Rik, 4932415O19Rik, NHE2
MMRRC Submission 044148-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R5963 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location40680574-40769273 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40682036 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 55 (S55G)
Ref Sequence ENSEMBL: ENSMUSP00000027231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027231] [ENSMUST00000192345]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027231
AA Change: S55G

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000027231
Gene: ENSMUSG00000026062
AA Change: S55G

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
low complexity region 40 60 N/A INTRINSIC
Pfam:Na_H_Exchanger 85 486 1.4e-95 PFAM
low complexity region 528 543 N/A INTRINSIC
Pfam:NEXCaM_BD 576 685 3e-44 PFAM
low complexity region 738 753 N/A INTRINSIC
low complexity region 788 793 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000192345
AA Change: S55G
SMART Domains Protein: ENSMUSP00000142144
Gene: ENSMUSG00000026062
AA Change: S55G

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
low complexity region 40 60 N/A INTRINSIC
Pfam:Na_H_Exchanger 85 336 2.5e-56 PFAM
Meta Mutation Damage Score 0.058 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.5%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium-hydrogen exchanger (NHE) protein family. These proteins are involved in sodium-ion transport by exchanging intracellular hydrogen ions to external sodium ions and help in the regulation of cell pH and volume. The encoded protein is localized to the apical membrane and is involved in apical absorption of sodium. [provided by RefSeq, Jun 2016]
PHENOTYPE: Gastric acid secretion is impaired in homozygous mutant mice. The gastric mucosa becomes inflamed and exhibits an altered cellular composition. Mutant mice do not breed well. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg8 A G 7: 97,379,830 K131E probably benign Het
Ank3 T A 10: 69,987,226 L575* probably null Het
Aqr T C 2: 114,126,961 T819A probably damaging Het
Bbs2 A T 8: 94,081,031 S407T probably benign Het
Bmper T A 9: 23,375,593 C272S probably benign Het
Btbd9 C T 17: 30,334,218 probably null Het
C5ar1 A G 7: 16,248,822 V91A possibly damaging Het
Ccdc138 A G 10: 58,575,757 H649R possibly damaging Het
Cfap43 A T 19: 47,745,574 V1451E probably benign Het
Cfap46 T A 7: 139,651,595 M901L probably damaging Het
Cherp G T 8: 72,461,535 probably benign Het
D430041D05Rik C T 2: 104,248,285 V1229I possibly damaging Het
Fat4 A C 3: 39,010,547 D4884A probably damaging Het
Fcrl5 T C 3: 87,444,173 F243L probably damaging Het
Garem1 T A 18: 21,129,430 I776F probably benign Het
Gpr87 T A 3: 59,179,269 R272* probably null Het
Gsdmc A T 15: 63,780,116 probably null Het
Hydin T A 8: 110,494,294 F1441I possibly damaging Het
Ints11 T A 4: 155,872,912 C63* probably null Het
Kdm4b A T 17: 56,399,732 T908S probably damaging Het
Lipn A G 19: 34,081,300 D304G probably damaging Het
Man2a1 T G 17: 64,675,122 N544K probably benign Het
Mapkapk5 G T 5: 121,538,481 H66N probably damaging Het
Mog G A 17: 37,012,348 R233* probably null Het
Mrps24 A T 11: 5,707,481 probably benign Het
Nom1 T C 5: 29,437,770 L423P probably damaging Het
Olfr65 T A 7: 103,906,961 V174E probably benign Het
Pcdha1 T A 18: 36,931,171 V296E probably damaging Het
Pdcd2 T C 17: 15,526,394 K168E possibly damaging Het
Pdcd2 G T 17: 15,526,395 H167Q probably damaging Het
Pla2g12b T A 10: 59,403,958 V63D probably damaging Het
Pnn C T 12: 59,067,831 R56* probably null Het
Primpol T A 8: 46,593,580 E227V possibly damaging Het
Rad54l A T 4: 116,110,387 W233R probably damaging Het
Rims2 A T 15: 39,437,182 D103V probably damaging Het
Rttn T C 18: 89,073,695 S1511P probably benign Het
Sept5 T C 16: 18,624,212 probably null Het
Simc1 T A 13: 54,525,819 I660K possibly damaging Het
Slc15a5 A G 6: 138,079,693 L75P probably damaging Het
Slit3 C T 11: 35,700,236 R1292C probably damaging Het
Slitrk3 A G 3: 73,050,713 V242A probably benign Het
St14 A T 9: 31,106,557 probably benign Het
Tnnt2 T C 1: 135,843,862 probably benign Het
Traf5 G A 1: 192,000,016 T288I probably benign Het
Trerf1 C T 17: 47,314,337 noncoding transcript Het
Vegfc A G 8: 54,181,284 N333D probably benign Het
Vmn1r65 T A 7: 6,008,609 I209F probably damaging Het
Vps51 A G 19: 6,068,290 L725P probably damaging Het
Vps8 T C 16: 21,470,121 I408T possibly damaging Het
Wdr72 T C 9: 74,145,028 Y114H probably damaging Het
Ybx2 A G 11: 69,941,092 E164G probably damaging Het
Zcchc14 A T 8: 121,628,623 probably benign Het
Zfp383 A G 7: 29,915,678 T453A possibly damaging Het
Zfp84 G T 7: 29,776,953 G357C probably damaging Het
Zmynd11 G T 13: 9,695,895 probably benign Het
Other mutations in Slc9a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Slc9a2 APN 1 40767737 missense probably benign
IGL00487:Slc9a2 APN 1 40742658 missense probably damaging 0.99
IGL00500:Slc9a2 APN 1 40763583 missense possibly damaging 0.95
IGL01445:Slc9a2 APN 1 40718810 missense possibly damaging 0.51
IGL02060:Slc9a2 APN 1 40756293 missense probably damaging 0.99
IGL02813:Slc9a2 APN 1 40742669 missense probably damaging 1.00
IGL02894:Slc9a2 APN 1 40763602 missense probably benign 0.20
IGL02939:Slc9a2 APN 1 40742703 missense probably damaging 1.00
IGL03193:Slc9a2 APN 1 40756271 missense probably benign 0.00
E0370:Slc9a2 UTSW 1 40763541 critical splice acceptor site probably null
PIT4377001:Slc9a2 UTSW 1 40743841 missense probably damaging 1.00
R0009:Slc9a2 UTSW 1 40763602 missense probably benign 0.38
R0009:Slc9a2 UTSW 1 40763602 missense probably benign 0.38
R0152:Slc9a2 UTSW 1 40742804 missense probably damaging 1.00
R0374:Slc9a2 UTSW 1 40743857 missense possibly damaging 0.93
R1386:Slc9a2 UTSW 1 40719018 missense probably damaging 1.00
R1485:Slc9a2 UTSW 1 40726388 missense probably damaging 1.00
R1712:Slc9a2 UTSW 1 40763610 missense possibly damaging 0.90
R1779:Slc9a2 UTSW 1 40742643 missense probably damaging 0.99
R2051:Slc9a2 UTSW 1 40726437 missense probably damaging 1.00
R2166:Slc9a2 UTSW 1 40742768 missense probably damaging 1.00
R2513:Slc9a2 UTSW 1 40742608 splice site probably null
R3612:Slc9a2 UTSW 1 40719058 splice site probably null
R4631:Slc9a2 UTSW 1 40761918 missense possibly damaging 0.66
R4760:Slc9a2 UTSW 1 40761916 missense probably damaging 1.00
R4768:Slc9a2 UTSW 1 40726374 missense probably damaging 1.00
R4769:Slc9a2 UTSW 1 40726374 missense probably damaging 1.00
R4815:Slc9a2 UTSW 1 40718849 missense probably benign 0.00
R4920:Slc9a2 UTSW 1 40755718 missense probably benign 0.05
R5191:Slc9a2 UTSW 1 40743893 missense probably damaging 1.00
R6322:Slc9a2 UTSW 1 40742653 nonsense probably null
R6453:Slc9a2 UTSW 1 40742621 missense possibly damaging 0.64
R6685:Slc9a2 UTSW 1 40718909 missense probably damaging 0.99
R7088:Slc9a2 UTSW 1 40726379 missense probably damaging 1.00
R7302:Slc9a2 UTSW 1 40767668 missense possibly damaging 0.58
R7450:Slc9a2 UTSW 1 40681835 start gained probably benign
X0054:Slc9a2 UTSW 1 40742687 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTTAGTAGTGCTGTCCCTCCC -3'
(R):5'- ACCAACTACTTGCCTACTTGG -3'

Sequencing Primer
(F):5'- TGCTGCGCTCATAGCTG -3'
(R):5'- AGGATCCCCAGTCTGATCGTC -3'
Posted On2017-03-31