Mutagenetix > Incidental Mutation

Incidental Mutation 'R5963:Slc9a2'

471857

Institutional Source

Beutler Lab

Gene Symbol

Slc9a2

Ensembl Gene

ENSMUSG00000026062

Gene Name

solute carrier family 9 (sodium/hydrogen exchanger), member 2

Synonyms

2210416H12Rik, 4932415O19Rik, NHE2

MMRRC Submission

044148-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.055) question?

Stock #

R5963 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

40680574-40769273 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 40682036 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 55 (S55G)

Ref Sequence

ENSEMBL: ENSMUSP00000027231 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027231] [ENSMUST00000192345]

AlphaFold

Q3ZAS0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000027231
AA Change: S55G

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000027231
Gene: ENSMUSG00000026062
AA Change: S55G

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
low complexity region	40	60	N/A	INTRINSIC
Pfam:Na_H_Exchanger	85	486	1.4e-95	PFAM
low complexity region	528	543	N/A	INTRINSIC
Pfam:NEXCaM_BD	576	685	3e-44	PFAM
low complexity region	738	753	N/A	INTRINSIC
low complexity region	788	793	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000192345
AA Change: S55G

SMART Domains

Protein: ENSMUSP00000142144
Gene: ENSMUSG00000026062
AA Change: S55G

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
low complexity region	40	60	N/A	INTRINSIC
Pfam:Na_H_Exchanger	85	336	2.5e-56	PFAM

Meta Mutation Damage Score

0.0660

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 92.5%

Validation Efficiency

99% (68/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium-hydrogen exchanger (NHE) protein family. These proteins are involved in sodium-ion transport by exchanging intracellular hydrogen ions to external sodium ions and help in the regulation of cell pH and volume. The encoded protein is localized to the apical membrane and is involved in apical absorption of sodium. [provided by RefSeq, Jun 2016]
PHENOTYPE: Gastric acid secretion is impaired in homozygous mutant mice. The gastric mucosa becomes inflamed and exhibits an altered cellular composition. Mutant mice do not breed well. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alg8	A	G	7: 97,379,830	K131E	probably benign	Het
Ank3	T	A	10: 69,987,226	L575*	probably null	Het
Aqr	T	C	2: 114,126,961	T819A	probably damaging	Het
Bbs2	A	T	8: 94,081,031	S407T	probably benign	Het
Bmper	T	A	9: 23,375,593	C272S	probably benign	Het
Btbd9	C	T	17: 30,334,218		probably null	Het
C5ar1	A	G	7: 16,248,822	V91A	possibly damaging	Het
Ccdc138	A	G	10: 58,575,757	H649R	possibly damaging	Het
Cfap43	A	T	19: 47,745,574	V1451E	probably benign	Het
Cfap46	T	A	7: 139,651,595	M901L	probably damaging	Het
Cherp	G	T	8: 72,461,535		probably benign	Het
D430041D05Rik	C	T	2: 104,248,285	V1229I	possibly damaging	Het
Fat4	A	C	3: 39,010,547	D4884A	probably damaging	Het
Fcrl5	T	C	3: 87,444,173	F243L	probably damaging	Het
Garem1	T	A	18: 21,129,430	I776F	probably benign	Het
Gpr87	T	A	3: 59,179,269	R272*	probably null	Het
Gsdmc	A	T	15: 63,780,116		probably null	Het
Hydin	T	A	8: 110,494,294	F1441I	possibly damaging	Het
Ints11	T	A	4: 155,872,912	C63*	probably null	Het
Kdm4b	A	T	17: 56,399,732	T908S	probably damaging	Het
Lipn	A	G	19: 34,081,300	D304G	probably damaging	Het
Man2a1	T	G	17: 64,675,122	N544K	probably benign	Het
Mapkapk5	G	T	5: 121,538,481	H66N	probably damaging	Het
Mog	G	A	17: 37,012,348	R233*	probably null	Het
Mrps24	A	T	11: 5,707,481		probably benign	Het
Nom1	T	C	5: 29,437,770	L423P	probably damaging	Het
Olfr65	T	A	7: 103,906,961	V174E	probably benign	Het
Pcdha1	T	A	18: 36,931,171	V296E	probably damaging	Het
Pdcd2	T	C	17: 15,526,394	K168E	possibly damaging	Het
Pdcd2	G	T	17: 15,526,395	H167Q	probably damaging	Het
Pla2g12b	T	A	10: 59,403,958	V63D	probably damaging	Het
Pnn	C	T	12: 59,067,831	R56*	probably null	Het
Primpol	T	A	8: 46,593,580	E227V	possibly damaging	Het
Rad54l	A	T	4: 116,110,387	W233R	probably damaging	Het
Rims2	A	T	15: 39,437,182	D103V	probably damaging	Het
Rttn	T	C	18: 89,073,695	S1511P	probably benign	Het
Sept5	T	C	16: 18,624,212		probably null	Het
Simc1	T	A	13: 54,525,819	I660K	possibly damaging	Het
Slc15a5	A	G	6: 138,079,693	L75P	probably damaging	Het
Slit3	C	T	11: 35,700,236	R1292C	probably damaging	Het
Slitrk3	A	G	3: 73,050,713	V242A	probably benign	Het
St14	A	T	9: 31,106,557		probably benign	Het
Tnnt2	T	C	1: 135,843,862		probably benign	Het
Traf5	G	A	1: 192,000,016	T288I	probably benign	Het
Trerf1	C	T	17: 47,314,337		noncoding transcript	Het
Vegfc	A	G	8: 54,181,284	N333D	probably benign	Het
Vmn1r65	T	A	7: 6,008,609	I209F	probably damaging	Het
Vps51	A	G	19: 6,068,290	L725P	probably damaging	Het
Vps8	T	C	16: 21,470,121	I408T	possibly damaging	Het
Wdr72	T	C	9: 74,145,028	Y114H	probably damaging	Het
Ybx2	A	G	11: 69,941,092	E164G	probably damaging	Het
Zcchc14	A	T	8: 121,628,623		probably benign	Het
Zfp383	A	G	7: 29,915,678	T453A	possibly damaging	Het
Zfp84	G	T	7: 29,776,953	G357C	probably damaging	Het
Zmynd11	G	T	13: 9,695,895		probably benign	Het

Other mutations in Slc9a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Slc9a2	APN	1	40767737	missense	probably benign
IGL00487:Slc9a2	APN	1	40742658	missense	probably damaging	0.99
IGL00500:Slc9a2	APN	1	40763583	missense	possibly damaging	0.95
IGL01445:Slc9a2	APN	1	40718810	missense	possibly damaging	0.51
IGL02060:Slc9a2	APN	1	40756293	missense	probably damaging	0.99
IGL02813:Slc9a2	APN	1	40742669	missense	probably damaging	1.00
IGL02894:Slc9a2	APN	1	40763602	missense	probably benign	0.20
IGL02939:Slc9a2	APN	1	40742703	missense	probably damaging	1.00
IGL03193:Slc9a2	APN	1	40756271	missense	probably benign	0.00
putty	UTSW	1	40742653	nonsense	probably null
E0370:Slc9a2	UTSW	1	40763541	critical splice acceptor site	probably null
PIT4377001:Slc9a2	UTSW	1	40743841	missense	probably damaging	1.00
R0009:Slc9a2	UTSW	1	40763602	missense	probably benign	0.38
R0009:Slc9a2	UTSW	1	40763602	missense	probably benign	0.38
R0152:Slc9a2	UTSW	1	40742804	missense	probably damaging	1.00
R0374:Slc9a2	UTSW	1	40743857	missense	possibly damaging	0.93
R1386:Slc9a2	UTSW	1	40719018	missense	probably damaging	1.00
R1485:Slc9a2	UTSW	1	40726388	missense	probably damaging	1.00
R1712:Slc9a2	UTSW	1	40763610	missense	possibly damaging	0.90
R1779:Slc9a2	UTSW	1	40742643	missense	probably damaging	0.99
R2051:Slc9a2	UTSW	1	40726437	missense	probably damaging	1.00
R2166:Slc9a2	UTSW	1	40742768	missense	probably damaging	1.00
R2513:Slc9a2	UTSW	1	40742608	splice site	probably null
R3612:Slc9a2	UTSW	1	40719058	splice site	probably null
R4631:Slc9a2	UTSW	1	40761918	missense	possibly damaging	0.66
R4760:Slc9a2	UTSW	1	40761916	missense	probably damaging	1.00
R4768:Slc9a2	UTSW	1	40726374	missense	probably damaging	1.00
R4769:Slc9a2	UTSW	1	40726374	missense	probably damaging	1.00
R4815:Slc9a2	UTSW	1	40718849	missense	probably benign	0.00
R4920:Slc9a2	UTSW	1	40755718	missense	probably benign	0.05
R5191:Slc9a2	UTSW	1	40743893	missense	probably damaging	1.00
R6322:Slc9a2	UTSW	1	40742653	nonsense	probably null
R6453:Slc9a2	UTSW	1	40742621	missense	possibly damaging	0.64
R6685:Slc9a2	UTSW	1	40718909	missense	probably damaging	0.99
R7088:Slc9a2	UTSW	1	40726379	missense	probably damaging	1.00
R7302:Slc9a2	UTSW	1	40767668	missense	possibly damaging	0.58
R7450:Slc9a2	UTSW	1	40681835	start gained	probably benign
R7670:Slc9a2	UTSW	1	40718997	missense	probably damaging	1.00
R7970:Slc9a2	UTSW	1	40726214	missense	probably damaging	0.98
R8104:Slc9a2	UTSW	1	40718649	missense	probably damaging	1.00
R8776:Slc9a2	UTSW	1	40742729	missense	probably damaging	1.00
R8776-TAIL:Slc9a2	UTSW	1	40742729	missense	probably damaging	1.00
R8887:Slc9a2	UTSW	1	40718849	missense	probably benign	0.01
R9028:Slc9a2	UTSW	1	40726452	missense	probably damaging	1.00
R9189:Slc9a2	UTSW	1	40755784	missense	probably benign	0.21
R9245:Slc9a2	UTSW	1	40766300	missense	probably benign	0.27
R9250:Slc9a2	UTSW	1	40767827	missense	probably benign	0.00
R9400:Slc9a2	UTSW	1	40719051	missense	possibly damaging	0.65
R9512:Slc9a2	UTSW	1	40682098	missense	probably damaging	0.98
R9583:Slc9a2	UTSW	1	40681901	missense	probably benign
X0054:Slc9a2	UTSW	1	40742687	missense	probably damaging	0.99
Z1176:Slc9a2	UTSW	1	40767711	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTTAGTAGTGCTGTCCCTCCC -3'
(R):5'- ACCAACTACTTGCCTACTTGG -3'

Sequencing Primer
(F):5'- TGCTGCGCTCATAGCTG -3'
(R):5'- AGGATCCCCAGTCTGATCGTC -3'

Posted On

2017-03-31