Incidental Mutation 'R5963:Fcrl5'
ID471865
Institutional Source Beutler Lab
Gene Symbol Fcrl5
Ensembl Gene ENSMUSG00000048031
Gene NameFc receptor-like 5
SynonymsBXMAS1-like protein 2, Fcrh3, mBXMH2
MMRRC Submission 044148-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R5963 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location87435773-87500678 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87444173 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 243 (F243L)
Ref Sequence ENSEMBL: ENSMUSP00000142210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049926] [ENSMUST00000166297] [ENSMUST00000178261] [ENSMUST00000193229] [ENSMUST00000194102]
Predicted Effect probably damaging
Transcript: ENSMUST00000049926
AA Change: F243L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050151
Gene: ENSMUSG00000048031
AA Change: F243L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IG 40 113 2.08e-1 SMART
IGc2 128 188 6.16e-4 SMART
IG_like 213 296 4.41e1 SMART
IGc2 316 380 3.97e-7 SMART
IG_like 410 473 2.94e-1 SMART
transmembrane domain 495 517 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166297
AA Change: F155L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131176
Gene: ENSMUSG00000048031
AA Change: F155L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IGc2 40 100 6.16e-4 SMART
IG_like 125 208 4.41e1 SMART
IGc2 228 292 3.97e-7 SMART
IG_like 322 385 2.94e-1 SMART
transmembrane domain 407 429 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000178261
AA Change: F243L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136046
Gene: ENSMUSG00000048031
AA Change: F243L

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
IG 40 113 2.08e-1 SMART
IGc2 128 188 6.16e-4 SMART
IG_like 213 296 4.41e1 SMART
IGc2 316 380 3.97e-7 SMART
IG_like 410 473 2.94e-1 SMART
transmembrane domain 495 517 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000193229
AA Change: F155L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000141311
Gene: ENSMUSG00000048031
AA Change: F155L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IGc2 40 100 6.16e-4 SMART
IG_like 125 208 4.41e1 SMART
IGc2 228 292 3.97e-7 SMART
IG_like 322 385 2.94e-1 SMART
transmembrane domain 407 429 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000194102
AA Change: F243L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142210
Gene: ENSMUSG00000048031
AA Change: F243L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IG 40 113 2.08e-1 SMART
IGc2 128 188 6.16e-4 SMART
IG_like 213 296 4.41e1 SMART
IGc2 316 380 3.97e-7 SMART
IG_like 410 473 2.94e-1 SMART
transmembrane domain 495 517 N/A INTRINSIC
Meta Mutation Damage Score 0.5319 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.5%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin receptor superfamily and the Fc-receptor like family. This gene and several other Fc receptor-like gene members are clustered on the long arm of chromosome 1. The encoded protein is a single-pass type I membrane protein and contains 8 immunoglobulin-like C2-type domains. This gene is implicated in B cell development and lymphomagenesis. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg8 A G 7: 97,379,830 K131E probably benign Het
Ank3 T A 10: 69,987,226 L575* probably null Het
Aqr T C 2: 114,126,961 T819A probably damaging Het
Bbs2 A T 8: 94,081,031 S407T probably benign Het
Bmper T A 9: 23,375,593 C272S probably benign Het
Btbd9 C T 17: 30,334,218 probably null Het
C5ar1 A G 7: 16,248,822 V91A possibly damaging Het
Ccdc138 A G 10: 58,575,757 H649R possibly damaging Het
Cfap43 A T 19: 47,745,574 V1451E probably benign Het
Cfap46 T A 7: 139,651,595 M901L probably damaging Het
Cherp G T 8: 72,461,535 probably benign Het
D430041D05Rik C T 2: 104,248,285 V1229I possibly damaging Het
Fat4 A C 3: 39,010,547 D4884A probably damaging Het
Garem1 T A 18: 21,129,430 I776F probably benign Het
Gpr87 T A 3: 59,179,269 R272* probably null Het
Gsdmc A T 15: 63,780,116 probably null Het
Hydin T A 8: 110,494,294 F1441I possibly damaging Het
Ints11 T A 4: 155,872,912 C63* probably null Het
Kdm4b A T 17: 56,399,732 T908S probably damaging Het
Lipn A G 19: 34,081,300 D304G probably damaging Het
Man2a1 T G 17: 64,675,122 N544K probably benign Het
Mapkapk5 G T 5: 121,538,481 H66N probably damaging Het
Mog G A 17: 37,012,348 R233* probably null Het
Mrps24 A T 11: 5,707,481 probably benign Het
Nom1 T C 5: 29,437,770 L423P probably damaging Het
Olfr65 T A 7: 103,906,961 V174E probably benign Het
Pcdha1 T A 18: 36,931,171 V296E probably damaging Het
Pdcd2 T C 17: 15,526,394 K168E possibly damaging Het
Pdcd2 G T 17: 15,526,395 H167Q probably damaging Het
Pla2g12b T A 10: 59,403,958 V63D probably damaging Het
Pnn C T 12: 59,067,831 R56* probably null Het
Primpol T A 8: 46,593,580 E227V possibly damaging Het
Rad54l A T 4: 116,110,387 W233R probably damaging Het
Rims2 A T 15: 39,437,182 D103V probably damaging Het
Rttn T C 18: 89,073,695 S1511P probably benign Het
Sept5 T C 16: 18,624,212 probably null Het
Simc1 T A 13: 54,525,819 I660K possibly damaging Het
Slc15a5 A G 6: 138,079,693 L75P probably damaging Het
Slc9a2 A G 1: 40,682,036 S55G possibly damaging Het
Slit3 C T 11: 35,700,236 R1292C probably damaging Het
Slitrk3 A G 3: 73,050,713 V242A probably benign Het
St14 A T 9: 31,106,557 probably benign Het
Tnnt2 T C 1: 135,843,862 probably benign Het
Traf5 G A 1: 192,000,016 T288I probably benign Het
Trerf1 C T 17: 47,314,337 noncoding transcript Het
Vegfc A G 8: 54,181,284 N333D probably benign Het
Vmn1r65 T A 7: 6,008,609 I209F probably damaging Het
Vps51 A G 19: 6,068,290 L725P probably damaging Het
Vps8 T C 16: 21,470,121 I408T possibly damaging Het
Wdr72 T C 9: 74,145,028 Y114H probably damaging Het
Ybx2 A G 11: 69,941,092 E164G probably damaging Het
Zcchc14 A T 8: 121,628,623 probably benign Het
Zfp383 A G 7: 29,915,678 T453A possibly damaging Het
Zfp84 G T 7: 29,776,953 G357C probably damaging Het
Zmynd11 G T 13: 9,695,895 probably benign Het
Other mutations in Fcrl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01743:Fcrl5 APN 3 87444291 missense probably damaging 0.96
IGL01868:Fcrl5 APN 3 87443707 missense possibly damaging 0.58
IGL01939:Fcrl5 APN 3 87446299 missense probably damaging 0.99
IGL02817:Fcrl5 APN 3 87435913 missense probably benign 0.35
IGL03106:Fcrl5 APN 3 87435883 splice site probably null
R0381:Fcrl5 UTSW 3 87446460 missense probably damaging 1.00
R0523:Fcrl5 UTSW 3 87457792 missense possibly damaging 0.72
R0646:Fcrl5 UTSW 3 87442013 missense probably benign 0.00
R1231:Fcrl5 UTSW 3 87442179 missense probably benign 0.13
R1353:Fcrl5 UTSW 3 87448362 missense probably damaging 1.00
R1711:Fcrl5 UTSW 3 87457414 missense possibly damaging 0.61
R1714:Fcrl5 UTSW 3 87446406 missense probably damaging 1.00
R1719:Fcrl5 UTSW 3 87457397 missense probably damaging 0.98
R2084:Fcrl5 UTSW 3 87444230 missense probably benign 0.24
R2358:Fcrl5 UTSW 3 87446419 missense probably damaging 0.99
R2884:Fcrl5 UTSW 3 87457391 missense probably damaging 1.00
R2885:Fcrl5 UTSW 3 87457391 missense probably damaging 1.00
R3085:Fcrl5 UTSW 3 87446464 missense probably damaging 1.00
R3153:Fcrl5 UTSW 3 87443680 missense probably benign 0.09
R4288:Fcrl5 UTSW 3 87442224 missense probably benign 0.09
R4289:Fcrl5 UTSW 3 87442224 missense probably benign 0.09
R4614:Fcrl5 UTSW 3 87448426 missense probably damaging 1.00
R4719:Fcrl5 UTSW 3 87444189 missense probably damaging 1.00
R4788:Fcrl5 UTSW 3 87457188 missense probably damaging 1.00
R4920:Fcrl5 UTSW 3 87444173 missense probably damaging 1.00
R4972:Fcrl5 UTSW 3 87454650 missense probably benign 0.00
R5373:Fcrl5 UTSW 3 87446391 missense probably benign 0.01
R5374:Fcrl5 UTSW 3 87446391 missense probably benign 0.01
R5975:Fcrl5 UTSW 3 87442103 missense probably benign 0.00
R6022:Fcrl5 UTSW 3 87455763 missense probably benign 0.42
R6267:Fcrl5 UTSW 3 87448324 missense probably damaging 1.00
R6372:Fcrl5 UTSW 3 87444194 nonsense probably null
R6393:Fcrl5 UTSW 3 87448327 missense probably damaging 1.00
R7088:Fcrl5 UTSW 3 87457834 makesense probably null
R7175:Fcrl5 UTSW 3 87446338 missense probably benign 0.37
R7210:Fcrl5 UTSW 3 87446412 missense possibly damaging 0.85
R7217:Fcrl5 UTSW 3 87443774 missense probably damaging 1.00
R7243:Fcrl5 UTSW 3 87442245 missense probably benign
R7776:Fcrl5 UTSW 3 87444195 missense possibly damaging 0.84
R7813:Fcrl5 UTSW 3 87443623 missense probably benign 0.09
R8357:Fcrl5 UTSW 3 87444260 missense probably damaging 0.99
R8457:Fcrl5 UTSW 3 87444260 missense probably damaging 0.99
X0054:Fcrl5 UTSW 3 87446299 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGGTTTTCTGCAGACTACTTAAC -3'
(R):5'- CCCAAACTGGTGAATGCTTC -3'

Sequencing Primer
(F):5'- GCAGACTACTTAACTGCTCAGTGG -3'
(R):5'- GAATGATACTCACTCTGCACTGG -3'
Posted On2017-03-31