Incidental Mutation 'R5963:Rad54l'
ID471866
Institutional Source Beutler Lab
Gene Symbol Rad54l
Ensembl Gene ENSMUSG00000028702
Gene NameRAD54 like (S. cerevisiae)
SynonymsRAD54
MMRRC Submission 044148-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5963 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location116094264-116123690 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 116110387 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 233 (W233R)
Ref Sequence ENSEMBL: ENSMUSP00000099766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102704] [ENSMUST00000102705]
Predicted Effect probably damaging
Transcript: ENSMUST00000102704
AA Change: W233R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099765
Gene: ENSMUSG00000028702
AA Change: W233R

DomainStartEndE-ValueType
DEXDc 149 357 1.66e-41 SMART
Blast:DEXDc 391 427 5e-13 BLAST
low complexity region 441 456 N/A INTRINSIC
HELICc 527 611 1.39e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102705
AA Change: W233R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099766
Gene: ENSMUSG00000028702
AA Change: W233R

DomainStartEndE-ValueType
Pfam:Rad54_N 10 138 7.8e-9 PFAM
DEXDc 149 357 1.66e-41 SMART
Blast:DEXDc 391 427 5e-13 BLAST
low complexity region 441 456 N/A INTRINSIC
HELICc 527 611 1.39e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138320
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152741
Meta Mutation Damage Score 0.9685 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.5%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the DEAD-like helicase superfamily, and shares similarity with Saccharomyces cerevisiae Rad54, a protein known to be involved in the homologous recombination and repair of DNA. This protein has been shown to play a role in homologous recombination related repair of DNA double-strand breaks. The binding of this protein to double-strand DNA induces a DNA topological change, which is thought to facilitate homologous DNA paring, and stimulate DNA recombination. Alternative splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are sensitive to DNA crosslinking agents and to ionizing radiation and show abnormal definitive hematopoiesis following X-ray treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg8 A G 7: 97,379,830 K131E probably benign Het
Ank3 T A 10: 69,987,226 L575* probably null Het
Aqr T C 2: 114,126,961 T819A probably damaging Het
Bbs2 A T 8: 94,081,031 S407T probably benign Het
Bmper T A 9: 23,375,593 C272S probably benign Het
Btbd9 C T 17: 30,334,218 probably null Het
C5ar1 A G 7: 16,248,822 V91A possibly damaging Het
Ccdc138 A G 10: 58,575,757 H649R possibly damaging Het
Cfap43 A T 19: 47,745,574 V1451E probably benign Het
Cfap46 T A 7: 139,651,595 M901L probably damaging Het
Cherp G T 8: 72,461,535 probably benign Het
D430041D05Rik C T 2: 104,248,285 V1229I possibly damaging Het
Fat4 A C 3: 39,010,547 D4884A probably damaging Het
Fcrl5 T C 3: 87,444,173 F243L probably damaging Het
Garem1 T A 18: 21,129,430 I776F probably benign Het
Gpr87 T A 3: 59,179,269 R272* probably null Het
Gsdmc A T 15: 63,780,116 probably null Het
Hydin T A 8: 110,494,294 F1441I possibly damaging Het
Ints11 T A 4: 155,872,912 C63* probably null Het
Kdm4b A T 17: 56,399,732 T908S probably damaging Het
Lipn A G 19: 34,081,300 D304G probably damaging Het
Man2a1 T G 17: 64,675,122 N544K probably benign Het
Mapkapk5 G T 5: 121,538,481 H66N probably damaging Het
Mog G A 17: 37,012,348 R233* probably null Het
Mrps24 A T 11: 5,707,481 probably benign Het
Nom1 T C 5: 29,437,770 L423P probably damaging Het
Olfr65 T A 7: 103,906,961 V174E probably benign Het
Pcdha1 T A 18: 36,931,171 V296E probably damaging Het
Pdcd2 G T 17: 15,526,395 H167Q probably damaging Het
Pdcd2 T C 17: 15,526,394 K168E possibly damaging Het
Pla2g12b T A 10: 59,403,958 V63D probably damaging Het
Pnn C T 12: 59,067,831 R56* probably null Het
Primpol T A 8: 46,593,580 E227V possibly damaging Het
Rims2 A T 15: 39,437,182 D103V probably damaging Het
Rttn T C 18: 89,073,695 S1511P probably benign Het
Sept5 T C 16: 18,624,212 probably null Het
Simc1 T A 13: 54,525,819 I660K possibly damaging Het
Slc15a5 A G 6: 138,079,693 L75P probably damaging Het
Slc9a2 A G 1: 40,682,036 S55G possibly damaging Het
Slit3 C T 11: 35,700,236 R1292C probably damaging Het
Slitrk3 A G 3: 73,050,713 V242A probably benign Het
St14 A T 9: 31,106,557 probably benign Het
Tnnt2 T C 1: 135,843,862 probably benign Het
Traf5 G A 1: 192,000,016 T288I probably benign Het
Trerf1 C T 17: 47,314,337 noncoding transcript Het
Vegfc A G 8: 54,181,284 N333D probably benign Het
Vmn1r65 T A 7: 6,008,609 I209F probably damaging Het
Vps51 A G 19: 6,068,290 L725P probably damaging Het
Vps8 T C 16: 21,470,121 I408T possibly damaging Het
Wdr72 T C 9: 74,145,028 Y114H probably damaging Het
Ybx2 A G 11: 69,941,092 E164G probably damaging Het
Zcchc14 A T 8: 121,628,623 probably benign Het
Zfp383 A G 7: 29,915,678 T453A possibly damaging Het
Zfp84 G T 7: 29,776,953 G357C probably damaging Het
Zmynd11 G T 13: 9,695,895 probably benign Het
Other mutations in Rad54l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01409:Rad54l APN 4 116105877 missense probably damaging 1.00
IGL01569:Rad54l APN 4 116098998 missense probably damaging 1.00
IGL02120:Rad54l APN 4 116098984 missense probably benign 0.44
IGL02587:Rad54l APN 4 116105797 missense probably damaging 1.00
IGL02728:Rad54l APN 4 116122949 missense probably benign 0.00
IGL03114:Rad54l APN 4 116098532 missense probably damaging 1.00
R0690:Rad54l UTSW 4 116099750 splice site probably benign
R1179:Rad54l UTSW 4 116111320 missense probably benign 0.14
R1956:Rad54l UTSW 4 116110357 missense probably damaging 0.99
R2875:Rad54l UTSW 4 116101853 missense probably benign 0.00
R2936:Rad54l UTSW 4 116122879 intron probably benign
R4237:Rad54l UTSW 4 116099449 missense probably damaging 1.00
R4344:Rad54l UTSW 4 116097354 missense probably damaging 1.00
R4801:Rad54l UTSW 4 116122924 missense probably null 0.12
R4802:Rad54l UTSW 4 116122924 missense probably null 0.12
R5106:Rad54l UTSW 4 116099764 intron probably benign
R5644:Rad54l UTSW 4 116098947 missense probably benign
R5684:Rad54l UTSW 4 116100563 missense probably damaging 1.00
R5883:Rad54l UTSW 4 116099046 intron probably benign
R6035:Rad54l UTSW 4 116097469 missense probably damaging 1.00
R6035:Rad54l UTSW 4 116097469 missense probably damaging 1.00
R6369:Rad54l UTSW 4 116111189 critical splice donor site probably null
R6863:Rad54l UTSW 4 116099669 missense probably damaging 1.00
R7135:Rad54l UTSW 4 116105830 missense probably damaging 1.00
R7318:Rad54l UTSW 4 116110709 missense possibly damaging 0.91
R7767:Rad54l UTSW 4 116099669 missense probably damaging 1.00
R8707:Rad54l UTSW 4 116097336 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCAGCTGTTTTCCAATGGC -3'
(R):5'- CTATGGGAGTGTGTCACCAG -3'

Sequencing Primer
(F):5'- AGCTGTTTTCCAATGGCAATTTC -3'
(R):5'- TCGAATTCCTGGAAGCCATG -3'
Posted On2017-03-31