Incidental Mutation 'R5963:Ints11'
ID471867
Institutional Source Beutler Lab
Gene Symbol Ints11
Ensembl Gene ENSMUSG00000029034
Gene Nameintegrator complex subunit 11
Synonyms2410006F12Rik, Cpsf3l
MMRRC Submission 044148-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5963 (G1)
Quality Score139
Status Validated
Chromosome4
Chromosomal Location155869546-155889103 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 155872912 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 63 (C63*)
Ref Sequence ENSEMBL: ENSMUSP00000118803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030901] [ENSMUST00000030950] [ENSMUST00000120794] [ENSMUST00000151961] [ENSMUST00000156460]
Predicted Effect probably null
Transcript: ENSMUST00000030901
AA Change: C63*
SMART Domains Protein: ENSMUSP00000030901
Gene: ENSMUSG00000029034
AA Change: C63*

DomainStartEndE-ValueType
Lactamase_B 16 233 3.38e-17 SMART
Beta-Casp 245 363 6.94e-37 SMART
Pfam:RMMBL 376 418 1.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000030950
SMART Domains Protein: ENSMUSP00000030950
Gene: ENSMUSG00000029073

DomainStartEndE-ValueType
Pfam:GLTP 27 179 1.4e-46 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000120794
AA Change: C63*
SMART Domains Protein: ENSMUSP00000112656
Gene: ENSMUSG00000029034
AA Change: C63*

DomainStartEndE-ValueType
Lactamase_B 16 211 6.42e-9 SMART
Beta-Casp 223 341 6.94e-37 SMART
Pfam:RMMBL 354 396 3.6e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149458
Predicted Effect probably benign
Transcript: ENSMUST00000151961
SMART Domains Protein: ENSMUSP00000115935
Gene: ENSMUSG00000029073

DomainStartEndE-ValueType
Pfam:GLTP 25 181 1.9e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156266
Predicted Effect probably null
Transcript: ENSMUST00000156460
AA Change: C63*
SMART Domains Protein: ENSMUSP00000118803
Gene: ENSMUSG00000029034
AA Change: C63*

DomainStartEndE-ValueType
SCOP:d1smla_ 1 66 7e-7 SMART
PDB:2I7V|A 3 38 1e-9 PDB
Blast:Lactamase_B 16 66 4e-30 BLAST
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.5%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Integrator complex contains at least 12 subunits and associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates the 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690). INTS11, or CPSF3L, is the catalytic subunit of the Integrator complex (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg8 A G 7: 97,379,830 K131E probably benign Het
Ank3 T A 10: 69,987,226 L575* probably null Het
Aqr T C 2: 114,126,961 T819A probably damaging Het
Bbs2 A T 8: 94,081,031 S407T probably benign Het
Bmper T A 9: 23,375,593 C272S probably benign Het
Btbd9 C T 17: 30,334,218 probably null Het
C5ar1 A G 7: 16,248,822 V91A possibly damaging Het
Ccdc138 A G 10: 58,575,757 H649R possibly damaging Het
Cfap43 A T 19: 47,745,574 V1451E probably benign Het
Cfap46 T A 7: 139,651,595 M901L probably damaging Het
Cherp G T 8: 72,461,535 probably benign Het
D430041D05Rik C T 2: 104,248,285 V1229I possibly damaging Het
Fat4 A C 3: 39,010,547 D4884A probably damaging Het
Fcrl5 T C 3: 87,444,173 F243L probably damaging Het
Garem1 T A 18: 21,129,430 I776F probably benign Het
Gpr87 T A 3: 59,179,269 R272* probably null Het
Gsdmc A T 15: 63,780,116 probably null Het
Hydin T A 8: 110,494,294 F1441I possibly damaging Het
Kdm4b A T 17: 56,399,732 T908S probably damaging Het
Lipn A G 19: 34,081,300 D304G probably damaging Het
Man2a1 T G 17: 64,675,122 N544K probably benign Het
Mapkapk5 G T 5: 121,538,481 H66N probably damaging Het
Mog G A 17: 37,012,348 R233* probably null Het
Mrps24 A T 11: 5,707,481 probably benign Het
Nom1 T C 5: 29,437,770 L423P probably damaging Het
Olfr65 T A 7: 103,906,961 V174E probably benign Het
Pcdha1 T A 18: 36,931,171 V296E probably damaging Het
Pdcd2 T C 17: 15,526,394 K168E possibly damaging Het
Pdcd2 G T 17: 15,526,395 H167Q probably damaging Het
Pla2g12b T A 10: 59,403,958 V63D probably damaging Het
Pnn C T 12: 59,067,831 R56* probably null Het
Primpol T A 8: 46,593,580 E227V possibly damaging Het
Rad54l A T 4: 116,110,387 W233R probably damaging Het
Rims2 A T 15: 39,437,182 D103V probably damaging Het
Rttn T C 18: 89,073,695 S1511P probably benign Het
Sept5 T C 16: 18,624,212 probably null Het
Simc1 T A 13: 54,525,819 I660K possibly damaging Het
Slc15a5 A G 6: 138,079,693 L75P probably damaging Het
Slc9a2 A G 1: 40,682,036 S55G possibly damaging Het
Slit3 C T 11: 35,700,236 R1292C probably damaging Het
Slitrk3 A G 3: 73,050,713 V242A probably benign Het
St14 A T 9: 31,106,557 probably benign Het
Tnnt2 T C 1: 135,843,862 probably benign Het
Traf5 G A 1: 192,000,016 T288I probably benign Het
Trerf1 C T 17: 47,314,337 noncoding transcript Het
Vegfc A G 8: 54,181,284 N333D probably benign Het
Vmn1r65 T A 7: 6,008,609 I209F probably damaging Het
Vps51 A G 19: 6,068,290 L725P probably damaging Het
Vps8 T C 16: 21,470,121 I408T possibly damaging Het
Wdr72 T C 9: 74,145,028 Y114H probably damaging Het
Ybx2 A G 11: 69,941,092 E164G probably damaging Het
Zcchc14 A T 8: 121,628,623 probably benign Het
Zfp383 A G 7: 29,915,678 T453A possibly damaging Het
Zfp84 G T 7: 29,776,953 G357C probably damaging Het
Zmynd11 G T 13: 9,695,895 probably benign Het
Other mutations in Ints11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01145:Ints11 APN 4 155885126 missense probably damaging 1.00
IGL01515:Ints11 APN 4 155875232 missense probably damaging 1.00
IGL01613:Ints11 APN 4 155885198 critical splice donor site probably null
IGL02024:Ints11 APN 4 155888515 missense probably damaging 1.00
IGL02127:Ints11 APN 4 155886863 missense probably damaging 1.00
IGL02850:Ints11 APN 4 155875304 missense probably benign 0.03
IGL02926:Ints11 APN 4 155888111 critical splice donor site probably null
IGL03296:Ints11 APN 4 155885323 critical splice donor site probably null
IGL03357:Ints11 APN 4 155872124 splice site probably benign
R0013:Ints11 UTSW 4 155887168 missense probably damaging 1.00
R0013:Ints11 UTSW 4 155887168 missense probably damaging 1.00
R0449:Ints11 UTSW 4 155887948 missense probably benign 0.17
R0480:Ints11 UTSW 4 155887624 missense probably damaging 1.00
R0589:Ints11 UTSW 4 155886886 missense probably damaging 1.00
R0678:Ints11 UTSW 4 155887753 missense probably damaging 1.00
R0865:Ints11 UTSW 4 155887107 splice site probably null
R1135:Ints11 UTSW 4 155887927 splice site probably null
R1466:Ints11 UTSW 4 155888110 critical splice donor site probably null
R1466:Ints11 UTSW 4 155888110 critical splice donor site probably null
R1658:Ints11 UTSW 4 155887728 missense probably damaging 0.97
R1707:Ints11 UTSW 4 155875198 missense probably benign 0.21
R2199:Ints11 UTSW 4 155875281 missense probably benign 0.07
R2876:Ints11 UTSW 4 155887425 unclassified probably benign
R4567:Ints11 UTSW 4 155885675 missense probably damaging 1.00
R4900:Ints11 UTSW 4 155888430 missense probably benign 0.01
R4964:Ints11 UTSW 4 155886928 missense probably damaging 1.00
R4966:Ints11 UTSW 4 155886928 missense probably damaging 1.00
R5306:Ints11 UTSW 4 155875208 missense probably damaging 1.00
R6246:Ints11 UTSW 4 155888089 missense probably benign
R7285:Ints11 UTSW 4 155886111 missense probably damaging 1.00
R7365:Ints11 UTSW 4 155872230 splice site probably null
R7768:Ints11 UTSW 4 155886939 missense probably damaging 0.97
R7774:Ints11 UTSW 4 155885683 missense probably benign 0.00
R7999:Ints11 UTSW 4 155886956 missense probably benign 0.12
R8103:Ints11 UTSW 4 155888230 missense possibly damaging 0.93
R8785:Ints11 UTSW 4 155869708 missense probably benign 0.17
Z1088:Ints11 UTSW 4 155886970 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- AGCAATGTAGGGGTCCTCTG -3'
(R):5'- AGGTACCTTGGCCATGTCTCTAC -3'

Sequencing Primer
(F):5'- TGATCCTTTGCTGGGGCCAC -3'
(R):5'- ATGTCTCTACTTCCTGGGGTAC -3'
Posted On2017-03-31