Incidental Mutation 'R5963:Mapkapk5'
ID471869
Institutional Source Beutler Lab
Gene Symbol Mapkapk5
Ensembl Gene ENSMUSG00000029454
Gene NameMAP kinase-activated protein kinase 5
SynonymsPRAK, MK5
MMRRC Submission 044148-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5963 (G1)
Quality Score158
Status Validated
Chromosome5
Chromosomal Location121525038-121545905 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 121538481 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 66 (H66N)
Ref Sequence ENSEMBL: ENSMUSP00000143668 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031410] [ENSMUST00000111782] [ENSMUST00000111783] [ENSMUST00000111786] [ENSMUST00000125946] [ENSMUST00000196315] [ENSMUST00000200170]
Predicted Effect probably damaging
Transcript: ENSMUST00000031410
AA Change: H66N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031410
Gene: ENSMUSG00000029454
AA Change: H66N

DomainStartEndE-ValueType
S_TKc 22 304 8.22e-84 SMART
coiled coil region 409 434 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000111781
SMART Domains Protein: ENSMUSP00000107411
Gene: ENSMUSG00000029454

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 200 1.9e-15 PFAM
Pfam:Pkinase 1 203 1.2e-48 PFAM
coiled coil region 308 333 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111782
SMART Domains Protein: ENSMUSP00000107412
Gene: ENSMUSG00000029454

DomainStartEndE-ValueType
Pfam:Pkinase 6 155 3.7e-27 PFAM
coiled coil region 258 283 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111783
AA Change: H66N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107413
Gene: ENSMUSG00000029454
AA Change: H66N

DomainStartEndE-ValueType
S_TKc 22 304 8.22e-84 SMART
coiled coil region 407 432 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111786
SMART Domains Protein: ENSMUSP00000107416
Gene: ENSMUSG00000029454

DomainStartEndE-ValueType
Pfam:Pkinase 6 155 3.8e-27 PFAM
coiled coil region 260 285 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000125946
AA Change: H66N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142503
Gene: ENSMUSG00000105340
AA Change: H66N

DomainStartEndE-ValueType
S_TKc 22 304 5.3e-84 SMART
coiled coil region 407 432 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131914
Predicted Effect probably benign
Transcript: ENSMUST00000151352
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153763
SMART Domains Protein: ENSMUSP00000119182
Gene: ENSMUSG00000029454

DomainStartEndE-ValueType
S_TKc 22 304 8.22e-84 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000196315
AA Change: H66N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142346
Gene: ENSMUSG00000029454
AA Change: H66N

DomainStartEndE-ValueType
STYKc 22 179 4.1e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000200170
AA Change: H66N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143668
Gene: ENSMUSG00000072647
AA Change: H66N

DomainStartEndE-ValueType
S_TKc 22 304 8.22e-84 SMART
coiled coil region 407 432 N/A INTRINSIC
Meta Mutation Damage Score 0.3806 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.5%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a tumor suppressor and member of the serine/threonine kinase family. In response to cellular stress and proinflammatory cytokines, this kinase is activated through its phosphorylation by MAP kinases including MAPK1/ERK, MAPK14/p38-alpha, and MAPK11/p38-beta. The encoded protein is found in the nucleus but translocates to the cytoplasm upon phosphorylation and activation. This kinase phosphorylates heat shock protein HSP27 at its physiologically relevant sites. Two alternately spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous mutant mice are viable, fertile, and show no overt abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg8 A G 7: 97,379,830 K131E probably benign Het
Ank3 T A 10: 69,987,226 L575* probably null Het
Aqr T C 2: 114,126,961 T819A probably damaging Het
Bbs2 A T 8: 94,081,031 S407T probably benign Het
Bmper T A 9: 23,375,593 C272S probably benign Het
Btbd9 C T 17: 30,334,218 probably null Het
C5ar1 A G 7: 16,248,822 V91A possibly damaging Het
Ccdc138 A G 10: 58,575,757 H649R possibly damaging Het
Cfap43 A T 19: 47,745,574 V1451E probably benign Het
Cfap46 T A 7: 139,651,595 M901L probably damaging Het
Cherp G T 8: 72,461,535 probably benign Het
D430041D05Rik C T 2: 104,248,285 V1229I possibly damaging Het
Fat4 A C 3: 39,010,547 D4884A probably damaging Het
Fcrl5 T C 3: 87,444,173 F243L probably damaging Het
Garem1 T A 18: 21,129,430 I776F probably benign Het
Gpr87 T A 3: 59,179,269 R272* probably null Het
Gsdmc A T 15: 63,780,116 probably null Het
Hydin T A 8: 110,494,294 F1441I possibly damaging Het
Ints11 T A 4: 155,872,912 C63* probably null Het
Kdm4b A T 17: 56,399,732 T908S probably damaging Het
Lipn A G 19: 34,081,300 D304G probably damaging Het
Man2a1 T G 17: 64,675,122 N544K probably benign Het
Mog G A 17: 37,012,348 R233* probably null Het
Mrps24 A T 11: 5,707,481 probably benign Het
Nom1 T C 5: 29,437,770 L423P probably damaging Het
Olfr65 T A 7: 103,906,961 V174E probably benign Het
Pcdha1 T A 18: 36,931,171 V296E probably damaging Het
Pdcd2 T C 17: 15,526,394 K168E possibly damaging Het
Pdcd2 G T 17: 15,526,395 H167Q probably damaging Het
Pla2g12b T A 10: 59,403,958 V63D probably damaging Het
Pnn C T 12: 59,067,831 R56* probably null Het
Primpol T A 8: 46,593,580 E227V possibly damaging Het
Rad54l A T 4: 116,110,387 W233R probably damaging Het
Rims2 A T 15: 39,437,182 D103V probably damaging Het
Rttn T C 18: 89,073,695 S1511P probably benign Het
Sept5 T C 16: 18,624,212 probably null Het
Simc1 T A 13: 54,525,819 I660K possibly damaging Het
Slc15a5 A G 6: 138,079,693 L75P probably damaging Het
Slc9a2 A G 1: 40,682,036 S55G possibly damaging Het
Slit3 C T 11: 35,700,236 R1292C probably damaging Het
Slitrk3 A G 3: 73,050,713 V242A probably benign Het
St14 A T 9: 31,106,557 probably benign Het
Tnnt2 T C 1: 135,843,862 probably benign Het
Traf5 G A 1: 192,000,016 T288I probably benign Het
Trerf1 C T 17: 47,314,337 noncoding transcript Het
Vegfc A G 8: 54,181,284 N333D probably benign Het
Vmn1r65 T A 7: 6,008,609 I209F probably damaging Het
Vps51 A G 19: 6,068,290 L725P probably damaging Het
Vps8 T C 16: 21,470,121 I408T possibly damaging Het
Wdr72 T C 9: 74,145,028 Y114H probably damaging Het
Ybx2 A G 11: 69,941,092 E164G probably damaging Het
Zcchc14 A T 8: 121,628,623 probably benign Het
Zfp383 A G 7: 29,915,678 T453A possibly damaging Het
Zfp84 G T 7: 29,776,953 G357C probably damaging Het
Zmynd11 G T 13: 9,695,895 probably benign Het
Other mutations in Mapkapk5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00938:Mapkapk5 APN 5 121537103 splice site probably benign
R1015:Mapkapk5 UTSW 5 121533362 missense probably benign 0.17
R2180:Mapkapk5 UTSW 5 121535864 splice site probably null
R4445:Mapkapk5 UTSW 5 121525228 missense probably benign
R4539:Mapkapk5 UTSW 5 121537155 missense possibly damaging 0.82
R5217:Mapkapk5 UTSW 5 121534429 missense probably damaging 1.00
R5229:Mapkapk5 UTSW 5 121533391 critical splice acceptor site probably null
R5422:Mapkapk5 UTSW 5 121531722 critical splice acceptor site probably null
R6378:Mapkapk5 UTSW 5 121539170 critical splice donor site probably null
R7021:Mapkapk5 UTSW 5 121527211 missense probably benign 0.02
R7303:Mapkapk5 UTSW 5 121540574 missense probably benign 0.02
R7360:Mapkapk5 UTSW 5 121537106 splice site probably benign
R7432:Mapkapk5 UTSW 5 121537171 missense possibly damaging 0.56
R7848:Mapkapk5 UTSW 5 121545169 missense probably benign 0.01
R7973:Mapkapk5 UTSW 5 121525713 missense possibly damaging 0.92
R8736:Mapkapk5 UTSW 5 121527178 missense possibly damaging 0.50
RF016:Mapkapk5 UTSW 5 121533316 missense probably damaging 1.00
Z1088:Mapkapk5 UTSW 5 121531591 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- AAATAAGATTCCCCAGGGGCTG -3'
(R):5'- AGATGGTCTGGACACTTTGG -3'

Sequencing Primer
(F):5'- TCAGCTTTTACAACACGAGAGAG -3'
(R):5'- GACTTAGCATGGTCAGGTTT -3'
Posted On2017-03-31