Incidental Mutation 'R5963:Olfr65'
ID471876
Institutional Source Beutler Lab
Gene Symbol Olfr65
Ensembl Gene ENSMUSG00000110259
Gene Nameolfactory receptor 65
Synonyms5'[b]3, GA_x6K02T2PBJ9-6634906-6633983, MOR1-2
MMRRC Submission 044148-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R5963 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103903487-103908650 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103906961 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 174 (V174E)
Ref Sequence ENSEMBL: ENSMUSP00000147914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106864] [ENSMUST00000209528] [ENSMUST00000214300]
Predicted Effect probably benign
Transcript: ENSMUST00000106864
AA Change: V171E

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000102477
Gene: ENSMUSG00000110259
AA Change: V171E

DomainStartEndE-ValueType
Pfam:7tm_4 32 310 2.1e-113 PFAM
Pfam:7TM_GPCR_Srsx 36 300 5.6e-7 PFAM
Pfam:7tm_1 42 293 5.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209528
AA Change: V174E

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000214300
AA Change: V171E

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Meta Mutation Damage Score 0.5071 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.5%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg8 A G 7: 97,379,830 K131E probably benign Het
Ank3 T A 10: 69,987,226 L575* probably null Het
Aqr T C 2: 114,126,961 T819A probably damaging Het
Bbs2 A T 8: 94,081,031 S407T probably benign Het
Bmper T A 9: 23,375,593 C272S probably benign Het
Btbd9 C T 17: 30,334,218 probably null Het
C5ar1 A G 7: 16,248,822 V91A possibly damaging Het
Ccdc138 A G 10: 58,575,757 H649R possibly damaging Het
Cfap43 A T 19: 47,745,574 V1451E probably benign Het
Cfap46 T A 7: 139,651,595 M901L probably damaging Het
Cherp G T 8: 72,461,535 probably benign Het
D430041D05Rik C T 2: 104,248,285 V1229I possibly damaging Het
Fat4 A C 3: 39,010,547 D4884A probably damaging Het
Fcrl5 T C 3: 87,444,173 F243L probably damaging Het
Garem1 T A 18: 21,129,430 I776F probably benign Het
Gpr87 T A 3: 59,179,269 R272* probably null Het
Gsdmc A T 15: 63,780,116 probably null Het
Hydin T A 8: 110,494,294 F1441I possibly damaging Het
Ints11 T A 4: 155,872,912 C63* probably null Het
Kdm4b A T 17: 56,399,732 T908S probably damaging Het
Lipn A G 19: 34,081,300 D304G probably damaging Het
Man2a1 T G 17: 64,675,122 N544K probably benign Het
Mapkapk5 G T 5: 121,538,481 H66N probably damaging Het
Mog G A 17: 37,012,348 R233* probably null Het
Mrps24 A T 11: 5,707,481 probably benign Het
Nom1 T C 5: 29,437,770 L423P probably damaging Het
Pcdha1 T A 18: 36,931,171 V296E probably damaging Het
Pdcd2 G T 17: 15,526,395 H167Q probably damaging Het
Pdcd2 T C 17: 15,526,394 K168E possibly damaging Het
Pla2g12b T A 10: 59,403,958 V63D probably damaging Het
Pnn C T 12: 59,067,831 R56* probably null Het
Primpol T A 8: 46,593,580 E227V possibly damaging Het
Rad54l A T 4: 116,110,387 W233R probably damaging Het
Rims2 A T 15: 39,437,182 D103V probably damaging Het
Rttn T C 18: 89,073,695 S1511P probably benign Het
Sept5 T C 16: 18,624,212 probably null Het
Simc1 T A 13: 54,525,819 I660K possibly damaging Het
Slc15a5 A G 6: 138,079,693 L75P probably damaging Het
Slc9a2 A G 1: 40,682,036 S55G possibly damaging Het
Slit3 C T 11: 35,700,236 R1292C probably damaging Het
Slitrk3 A G 3: 73,050,713 V242A probably benign Het
St14 A T 9: 31,106,557 probably benign Het
Tnnt2 T C 1: 135,843,862 probably benign Het
Traf5 G A 1: 192,000,016 T288I probably benign Het
Trerf1 C T 17: 47,314,337 noncoding transcript Het
Vegfc A G 8: 54,181,284 N333D probably benign Het
Vmn1r65 T A 7: 6,008,609 I209F probably damaging Het
Vps51 A G 19: 6,068,290 L725P probably damaging Het
Vps8 T C 16: 21,470,121 I408T possibly damaging Het
Wdr72 T C 9: 74,145,028 Y114H probably damaging Het
Ybx2 A G 11: 69,941,092 E164G probably damaging Het
Zcchc14 A T 8: 121,628,623 probably benign Het
Zfp383 A G 7: 29,915,678 T453A possibly damaging Het
Zfp84 G T 7: 29,776,953 G357C probably damaging Het
Zmynd11 G T 13: 9,695,895 probably benign Het
Other mutations in Olfr65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01079:Olfr65 APN 7 103906462 missense probably benign
IGL02830:Olfr65 APN 7 103906444 missense probably benign 0.32
IGL03238:Olfr65 APN 7 103906510 missense probably benign
R0674:Olfr65 UTSW 7 103907255 missense probably benign 0.01
R1711:Olfr65 UTSW 7 103906699 missense probably damaging 1.00
R2018:Olfr65 UTSW 7 103907042 missense possibly damaging 0.88
R2363:Olfr65 UTSW 7 103907060 missense probably benign 0.19
R2968:Olfr65 UTSW 7 103907312 missense probably benign 0.01
R2970:Olfr65 UTSW 7 103907312 missense probably benign 0.01
R3746:Olfr65 UTSW 7 103907060 missense probably benign 0.19
R4928:Olfr65 UTSW 7 103906672 missense probably damaging 1.00
R5092:Olfr65 UTSW 7 103907199 nonsense probably null
R5635:Olfr65 UTSW 7 103906638 missense probably benign 0.05
R5881:Olfr65 UTSW 7 103906676 missense probably damaging 0.98
R5969:Olfr65 UTSW 7 103906910 missense probably damaging 0.98
R6859:Olfr65 UTSW 7 103906701 nonsense probably null
R7857:Olfr65 UTSW 7 103906610 missense
R8065:Olfr65 UTSW 7 103906403 start gained probably benign
R8067:Olfr65 UTSW 7 103906403 start gained probably benign
R8381:Olfr65 UTSW 7 103906939 missense
R8501:Olfr65 UTSW 7 103906611 missense
R8737:Olfr65 UTSW 7 103906706 missense
R8796:Olfr65 UTSW 7 103906994 missense
X0065:Olfr65 UTSW 7 103907216 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAATTGGCCATGGAGCCTG -3'
(R):5'- CAATGCCCATGACAGTCTTG -3'

Sequencing Primer
(F):5'- ACACTCTCTCTATTGTGGAGTCGG -3'
(R):5'- TGCCCATGACAGTCTTGAGAATC -3'
Posted On2017-03-31