Mutagenetix > Incidental Mutations

Incidental Mutation 'R5963:Vegfc'

471879

Institutional Source

Beutler Lab

Gene Symbol

Vegfc

Ensembl Gene

ENSMUSG00000031520

Gene Name

vascular endothelial growth factor C

Synonyms

VEGF-C

MMRRC Submission

044148-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5963 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

54077606-54187096 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 54181284 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 333 (N333D)

Ref Sequence

ENSEMBL: ENSMUSP00000033919 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033919] [ENSMUST00000210831]

Predicted Effect

probably benign
Transcript: ENSMUST00000033919
AA Change: N333D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000033919
Gene: ENSMUSG00000031520
AA Change: N333D

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
PDGF	125	209	5.07e-48	SMART
Pfam:CXCXC	279	291	1.6e-7	PFAM
Pfam:CXCXC	327	339	1.5e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000210831

Meta Mutation Damage Score

0.0582

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 92.5%

Validation Efficiency

99% (68/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the platelet-derived growth factor/vascular endothelial growth factor (PDGF/VEGF) family. The encoded protein promotes angiogenesis and endothelial cell growth, and can also affect the permeability of blood vessels. The proprotein is further cleaved into a fully processed form that can bind and activate VEGFR-2 and VEGFR-3 receptors. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mutation of this gene affects the development of the lymphatic system. Homozygous inactivation is embryonic lethal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alg8	A	G	7: 97,379,830	K131E	probably benign	Het
Ank3	T	A	10: 69,987,226	L575*	probably null	Het
Aqr	T	C	2: 114,126,961	T819A	probably damaging	Het
Bbs2	A	T	8: 94,081,031	S407T	probably benign	Het
Bmper	T	A	9: 23,375,593	C272S	probably benign	Het
Btbd9	C	T	17: 30,334,218		probably null	Het
C5ar1	A	G	7: 16,248,822	V91A	possibly damaging	Het
Ccdc138	A	G	10: 58,575,757	H649R	possibly damaging	Het
Cfap43	A	T	19: 47,745,574	V1451E	probably benign	Het
Cfap46	T	A	7: 139,651,595	M901L	probably damaging	Het
Cherp	G	T	8: 72,461,535		probably benign	Het
D430041D05Rik	C	T	2: 104,248,285	V1229I	possibly damaging	Het
Fat4	A	C	3: 39,010,547	D4884A	probably damaging	Het
Fcrl5	T	C	3: 87,444,173	F243L	probably damaging	Het
Garem1	T	A	18: 21,129,430	I776F	probably benign	Het
Gpr87	T	A	3: 59,179,269	R272*	probably null	Het
Gsdmc	A	T	15: 63,780,116		probably null	Het
Hydin	T	A	8: 110,494,294	F1441I	possibly damaging	Het
Ints11	T	A	4: 155,872,912	C63*	probably null	Het
Kdm4b	A	T	17: 56,399,732	T908S	probably damaging	Het
Lipn	A	G	19: 34,081,300	D304G	probably damaging	Het
Man2a1	T	G	17: 64,675,122	N544K	probably benign	Het
Mapkapk5	G	T	5: 121,538,481	H66N	probably damaging	Het
Mog	G	A	17: 37,012,348	R233*	probably null	Het
Mrps24	A	T	11: 5,707,481		probably benign	Het
Nom1	T	C	5: 29,437,770	L423P	probably damaging	Het
Olfr65	T	A	7: 103,906,961	V174E	probably benign	Het
Pcdha1	T	A	18: 36,931,171	V296E	probably damaging	Het
Pdcd2	T	C	17: 15,526,394	K168E	possibly damaging	Het
Pdcd2	G	T	17: 15,526,395	H167Q	probably damaging	Het
Pla2g12b	T	A	10: 59,403,958	V63D	probably damaging	Het
Pnn	C	T	12: 59,067,831	R56*	probably null	Het
Primpol	T	A	8: 46,593,580	E227V	possibly damaging	Het
Rad54l	A	T	4: 116,110,387	W233R	probably damaging	Het
Rims2	A	T	15: 39,437,182	D103V	probably damaging	Het
Rttn	T	C	18: 89,073,695	S1511P	probably benign	Het
Sept5	T	C	16: 18,624,212		probably null	Het
Simc1	T	A	13: 54,525,819	I660K	possibly damaging	Het
Slc15a5	A	G	6: 138,079,693	L75P	probably damaging	Het
Slc9a2	A	G	1: 40,682,036	S55G	possibly damaging	Het
Slit3	C	T	11: 35,700,236	R1292C	probably damaging	Het
Slitrk3	A	G	3: 73,050,713	V242A	probably benign	Het
St14	A	T	9: 31,106,557		probably benign	Het
Tnnt2	T	C	1: 135,843,862		probably benign	Het
Traf5	G	A	1: 192,000,016	T288I	probably benign	Het
Trerf1	C	T	17: 47,314,337		noncoding transcript	Het
Vmn1r65	T	A	7: 6,008,609	I209F	probably damaging	Het
Vps51	A	G	19: 6,068,290	L725P	probably damaging	Het
Vps8	T	C	16: 21,470,121	I408T	possibly damaging	Het
Wdr72	T	C	9: 74,145,028	Y114H	probably damaging	Het
Ybx2	A	G	11: 69,941,092	E164G	probably damaging	Het
Zcchc14	A	T	8: 121,628,623		probably benign	Het
Zfp383	A	G	7: 29,915,678	T453A	possibly damaging	Het
Zfp84	G	T	7: 29,776,953	G357C	probably damaging	Het
Zmynd11	G	T	13: 9,695,895		probably benign	Het

Other mutations in Vegfc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00658:Vegfc	APN	8	54156948	splice site	probably benign
IGL02120:Vegfc	APN	8	54181401	missense	possibly damaging	0.96
IGL03344:Vegfc	APN	8	54157151	missense	possibly damaging	0.64
R0620:Vegfc	UTSW	8	54157139	missense	probably benign	0.01
R1167:Vegfc	UTSW	8	54186043	missense	probably benign	0.06
R1826:Vegfc	UTSW	8	54181312	missense	possibly damaging	0.88
R4151:Vegfc	UTSW	8	54077789	missense	unknown
R4226:Vegfc	UTSW	8	54159410	missense	probably damaging	1.00
R4227:Vegfc	UTSW	8	54159410	missense	probably damaging	1.00
R4414:Vegfc	UTSW	8	54181095	missense	probably benign	0.02
R6241:Vegfc	UTSW	8	54181254	missense	probably benign	0.00
R6368:Vegfc	UTSW	8	54181230	missense	probably damaging	1.00
R6728:Vegfc	UTSW	8	54186022	missense	probably damaging	0.99
R7044:Vegfc	UTSW	8	54157045	missense	possibly damaging	0.89
R7776:Vegfc	UTSW	8	54077800	missense	unknown

Predicted Primers

PCR Primer
(F):5'- CATGATGTCTGTGGACCCAAC -3'
(R):5'- GGTATGGGTTTAGAAAACAGCTTC -3'

Sequencing Primer
(F):5'- TCTGTGGACCCAACAAGGAGC -3'
(R):5'- GGTTTAGAAAACAGCTTCAGGTTG -3'

Posted On

2017-03-31