Incidental Mutation 'R5963:Vegfc'
ID 471879
Institutional Source Beutler Lab
Gene Symbol Vegfc
Ensembl Gene ENSMUSG00000031520
Gene Name vascular endothelial growth factor C
Synonyms VEGF-C
MMRRC Submission 044148-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5963 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 54077606-54187096 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 54181284 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 333 (N333D)
Ref Sequence ENSEMBL: ENSMUSP00000033919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033919] [ENSMUST00000210831]
AlphaFold P97953
Predicted Effect probably benign
Transcript: ENSMUST00000033919
AA Change: N333D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000033919
Gene: ENSMUSG00000031520
AA Change: N333D

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
PDGF 125 209 5.07e-48 SMART
Pfam:CXCXC 279 291 1.6e-7 PFAM
Pfam:CXCXC 327 339 1.5e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000210831
Meta Mutation Damage Score 0.0582 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.5%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the platelet-derived growth factor/vascular endothelial growth factor (PDGF/VEGF) family. The encoded protein promotes angiogenesis and endothelial cell growth, and can also affect the permeability of blood vessels. The proprotein is further cleaved into a fully processed form that can bind and activate VEGFR-2 and VEGFR-3 receptors. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mutation of this gene affects the development of the lymphatic system. Homozygous inactivation is embryonic lethal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg8 A G 7: 97,379,830 K131E probably benign Het
Ank3 T A 10: 69,987,226 L575* probably null Het
Aqr T C 2: 114,126,961 T819A probably damaging Het
Bbs2 A T 8: 94,081,031 S407T probably benign Het
Bmper T A 9: 23,375,593 C272S probably benign Het
Btbd9 C T 17: 30,334,218 probably null Het
C5ar1 A G 7: 16,248,822 V91A possibly damaging Het
Ccdc138 A G 10: 58,575,757 H649R possibly damaging Het
Cfap43 A T 19: 47,745,574 V1451E probably benign Het
Cfap46 T A 7: 139,651,595 M901L probably damaging Het
Cherp G T 8: 72,461,535 probably benign Het
D430041D05Rik C T 2: 104,248,285 V1229I possibly damaging Het
Fat4 A C 3: 39,010,547 D4884A probably damaging Het
Fcrl5 T C 3: 87,444,173 F243L probably damaging Het
Garem1 T A 18: 21,129,430 I776F probably benign Het
Gpr87 T A 3: 59,179,269 R272* probably null Het
Gsdmc A T 15: 63,780,116 probably null Het
Hydin T A 8: 110,494,294 F1441I possibly damaging Het
Ints11 T A 4: 155,872,912 C63* probably null Het
Kdm4b A T 17: 56,399,732 T908S probably damaging Het
Lipn A G 19: 34,081,300 D304G probably damaging Het
Man2a1 T G 17: 64,675,122 N544K probably benign Het
Mapkapk5 G T 5: 121,538,481 H66N probably damaging Het
Mog G A 17: 37,012,348 R233* probably null Het
Mrps24 A T 11: 5,707,481 probably benign Het
Nom1 T C 5: 29,437,770 L423P probably damaging Het
Olfr65 T A 7: 103,906,961 V174E probably benign Het
Pcdha1 T A 18: 36,931,171 V296E probably damaging Het
Pdcd2 T C 17: 15,526,394 K168E possibly damaging Het
Pdcd2 G T 17: 15,526,395 H167Q probably damaging Het
Pla2g12b T A 10: 59,403,958 V63D probably damaging Het
Pnn C T 12: 59,067,831 R56* probably null Het
Primpol T A 8: 46,593,580 E227V possibly damaging Het
Rad54l A T 4: 116,110,387 W233R probably damaging Het
Rims2 A T 15: 39,437,182 D103V probably damaging Het
Rttn T C 18: 89,073,695 S1511P probably benign Het
Sept5 T C 16: 18,624,212 probably null Het
Simc1 T A 13: 54,525,819 I660K possibly damaging Het
Slc15a5 A G 6: 138,079,693 L75P probably damaging Het
Slc9a2 A G 1: 40,682,036 S55G possibly damaging Het
Slit3 C T 11: 35,700,236 R1292C probably damaging Het
Slitrk3 A G 3: 73,050,713 V242A probably benign Het
St14 A T 9: 31,106,557 probably benign Het
Tnnt2 T C 1: 135,843,862 probably benign Het
Traf5 G A 1: 192,000,016 T288I probably benign Het
Trerf1 C T 17: 47,314,337 noncoding transcript Het
Vmn1r65 T A 7: 6,008,609 I209F probably damaging Het
Vps51 A G 19: 6,068,290 L725P probably damaging Het
Vps8 T C 16: 21,470,121 I408T possibly damaging Het
Wdr72 T C 9: 74,145,028 Y114H probably damaging Het
Ybx2 A G 11: 69,941,092 E164G probably damaging Het
Zcchc14 A T 8: 121,628,623 probably benign Het
Zfp383 A G 7: 29,915,678 T453A possibly damaging Het
Zfp84 G T 7: 29,776,953 G357C probably damaging Het
Zmynd11 G T 13: 9,695,895 probably benign Het
Other mutations in Vegfc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00658:Vegfc APN 8 54156948 splice site probably benign
IGL02120:Vegfc APN 8 54181401 missense possibly damaging 0.96
IGL03344:Vegfc APN 8 54157151 missense possibly damaging 0.64
R0620:Vegfc UTSW 8 54157139 missense probably benign 0.01
R1167:Vegfc UTSW 8 54186043 missense probably benign 0.06
R1826:Vegfc UTSW 8 54181312 missense possibly damaging 0.88
R4151:Vegfc UTSW 8 54077789 missense unknown
R4226:Vegfc UTSW 8 54159410 missense probably damaging 1.00
R4227:Vegfc UTSW 8 54159410 missense probably damaging 1.00
R4414:Vegfc UTSW 8 54181095 missense probably benign 0.02
R6241:Vegfc UTSW 8 54181254 missense probably benign 0.00
R6368:Vegfc UTSW 8 54181230 missense probably damaging 1.00
R6728:Vegfc UTSW 8 54186022 missense probably damaging 0.99
R7044:Vegfc UTSW 8 54157045 missense possibly damaging 0.89
R7776:Vegfc UTSW 8 54077800 missense unknown
R9374:Vegfc UTSW 8 54169145 missense possibly damaging 0.95
R9449:Vegfc UTSW 8 54157018 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CATGATGTCTGTGGACCCAAC -3'
(R):5'- GGTATGGGTTTAGAAAACAGCTTC -3'

Sequencing Primer
(F):5'- TCTGTGGACCCAACAAGGAGC -3'
(R):5'- GGTTTAGAAAACAGCTTCAGGTTG -3'
Posted On 2017-03-31