Incidental Mutation 'R5963:Bbs2'
ID471881
Institutional Source Beutler Lab
Gene Symbol Bbs2
Ensembl Gene ENSMUSG00000031755
Gene NameBardet-Biedl syndrome 2 (human)
Synonyms2410125H22Rik
MMRRC Submission 044148-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.746) question?
Stock #R5963 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location94067954-94098928 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 94081031 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 407 (S407T)
Ref Sequence ENSEMBL: ENSMUSP00000034206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034206]
Predicted Effect probably benign
Transcript: ENSMUST00000034206
AA Change: S407T

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000034206
Gene: ENSMUSG00000031755
AA Change: S407T

DomainStartEndE-ValueType
Pfam:BBS2_N 20 161 1.4e-62 PFAM
Pfam:BBS2_Mid 162 272 6.9e-50 PFAM
Pfam:BBS2_C 276 715 2.6e-193 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172347
Meta Mutation Damage Score 0.0598 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.5%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Bardet-Biedl syndrome (BBS) gene family. Bardet-Biedl syndrome is an autosomal recessive disorder characterized by severe pigmentary retinopathy, obesity, polydactyly, renal malformation and mental retardation. The proteins encoded by BBS gene family members are structurally diverse and the similar phenotypes exhibited by mutations in BBS gene family members is likely due to their shared roles in cilia formation and function. Many BBS proteins localize to the basal bodies, ciliary axonemes, and pericentriolar regions of cells. BBS proteins may also be involved in intracellular trafficking via microtubule-related transport. The protein encoded by this gene forms a multiprotein BBSome complex with seven other BBS proteins.[provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygous null mice display obesity associated with polyphagia, retinopathy associated with mislocalization of rhodopsin, cilia defects, renal cysts, male sterility, abnormal brain neuroanatomy, reduced salivation and acoustic startle response, an olfactory deficit and abnormal social interaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg8 A G 7: 97,379,830 K131E probably benign Het
Ank3 T A 10: 69,987,226 L575* probably null Het
Aqr T C 2: 114,126,961 T819A probably damaging Het
Bmper T A 9: 23,375,593 C272S probably benign Het
Btbd9 C T 17: 30,334,218 probably null Het
C5ar1 A G 7: 16,248,822 V91A possibly damaging Het
Ccdc138 A G 10: 58,575,757 H649R possibly damaging Het
Cfap43 A T 19: 47,745,574 V1451E probably benign Het
Cfap46 T A 7: 139,651,595 M901L probably damaging Het
Cherp G T 8: 72,461,535 probably benign Het
D430041D05Rik C T 2: 104,248,285 V1229I possibly damaging Het
Fat4 A C 3: 39,010,547 D4884A probably damaging Het
Fcrl5 T C 3: 87,444,173 F243L probably damaging Het
Garem1 T A 18: 21,129,430 I776F probably benign Het
Gpr87 T A 3: 59,179,269 R272* probably null Het
Gsdmc A T 15: 63,780,116 probably null Het
Hydin T A 8: 110,494,294 F1441I possibly damaging Het
Ints11 T A 4: 155,872,912 C63* probably null Het
Kdm4b A T 17: 56,399,732 T908S probably damaging Het
Lipn A G 19: 34,081,300 D304G probably damaging Het
Man2a1 T G 17: 64,675,122 N544K probably benign Het
Mapkapk5 G T 5: 121,538,481 H66N probably damaging Het
Mog G A 17: 37,012,348 R233* probably null Het
Mrps24 A T 11: 5,707,481 probably benign Het
Nom1 T C 5: 29,437,770 L423P probably damaging Het
Olfr65 T A 7: 103,906,961 V174E probably benign Het
Pcdha1 T A 18: 36,931,171 V296E probably damaging Het
Pdcd2 T C 17: 15,526,394 K168E possibly damaging Het
Pdcd2 G T 17: 15,526,395 H167Q probably damaging Het
Pla2g12b T A 10: 59,403,958 V63D probably damaging Het
Pnn C T 12: 59,067,831 R56* probably null Het
Primpol T A 8: 46,593,580 E227V possibly damaging Het
Rad54l A T 4: 116,110,387 W233R probably damaging Het
Rims2 A T 15: 39,437,182 D103V probably damaging Het
Rttn T C 18: 89,073,695 S1511P probably benign Het
Sept5 T C 16: 18,624,212 probably null Het
Simc1 T A 13: 54,525,819 I660K possibly damaging Het
Slc15a5 A G 6: 138,079,693 L75P probably damaging Het
Slc9a2 A G 1: 40,682,036 S55G possibly damaging Het
Slit3 C T 11: 35,700,236 R1292C probably damaging Het
Slitrk3 A G 3: 73,050,713 V242A probably benign Het
St14 A T 9: 31,106,557 probably benign Het
Tnnt2 T C 1: 135,843,862 probably benign Het
Traf5 G A 1: 192,000,016 T288I probably benign Het
Trerf1 C T 17: 47,314,337 noncoding transcript Het
Vegfc A G 8: 54,181,284 N333D probably benign Het
Vmn1r65 T A 7: 6,008,609 I209F probably damaging Het
Vps51 A G 19: 6,068,290 L725P probably damaging Het
Vps8 T C 16: 21,470,121 I408T possibly damaging Het
Wdr72 T C 9: 74,145,028 Y114H probably damaging Het
Ybx2 A G 11: 69,941,092 E164G probably damaging Het
Zcchc14 A T 8: 121,628,623 probably benign Het
Zfp383 A G 7: 29,915,678 T453A possibly damaging Het
Zfp84 G T 7: 29,776,953 G357C probably damaging Het
Zmynd11 G T 13: 9,695,895 probably benign Het
Other mutations in Bbs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00678:Bbs2 APN 8 94089167 critical splice acceptor site probably null
IGL02250:Bbs2 APN 8 94092426 missense probably benign 0.22
IGL02427:Bbs2 APN 8 94081118 missense possibly damaging 0.92
IGL02810:Bbs2 APN 8 94086911 missense probably benign 0.00
IGL02850:Bbs2 APN 8 94077082 missense probably benign
IGL03050:Bbs2 APN 8 94074413 splice site probably benign
IGL03292:Bbs2 APN 8 94075121 critical splice donor site probably null
Gosling UTSW 8 94082490 missense possibly damaging 0.95
rolie UTSW 8 94082364 missense probably damaging 0.96
BB007:Bbs2 UTSW 8 94069997 missense probably damaging 1.00
BB017:Bbs2 UTSW 8 94069997 missense probably damaging 1.00
R0755:Bbs2 UTSW 8 94082080 missense probably benign 0.22
R0835:Bbs2 UTSW 8 94075259 missense probably damaging 1.00
R1404:Bbs2 UTSW 8 94081999 missense probably null 0.01
R1404:Bbs2 UTSW 8 94081999 missense probably null 0.01
R1513:Bbs2 UTSW 8 94089844 missense possibly damaging 0.94
R1972:Bbs2 UTSW 8 94081177 splice site probably benign
R4648:Bbs2 UTSW 8 94080879 missense probably damaging 1.00
R4876:Bbs2 UTSW 8 94070160 unclassified probably benign
R4911:Bbs2 UTSW 8 94089115 missense probably damaging 1.00
R4966:Bbs2 UTSW 8 94080807 missense probably damaging 1.00
R4982:Bbs2 UTSW 8 94082354 critical splice donor site probably null
R5202:Bbs2 UTSW 8 94092414 nonsense probably null
R5347:Bbs2 UTSW 8 94092550 missense probably damaging 0.98
R5364:Bbs2 UTSW 8 94074395 missense probably benign 0.00
R5538:Bbs2 UTSW 8 94089763 missense probably damaging 1.00
R5685:Bbs2 UTSW 8 94087433 missense probably damaging 1.00
R5918:Bbs2 UTSW 8 94098303 missense probably damaging 0.98
R5964:Bbs2 UTSW 8 94068367 missense probably benign 0.18
R5991:Bbs2 UTSW 8 94098286 missense probably benign 0.24
R6050:Bbs2 UTSW 8 94092532 missense probably damaging 1.00
R6172:Bbs2 UTSW 8 94087411 missense probably benign 0.02
R6241:Bbs2 UTSW 8 94098235 critical splice donor site probably null
R6578:Bbs2 UTSW 8 94077041 missense probably null 0.00
R7330:Bbs2 UTSW 8 94087405 missense possibly damaging 0.78
R7404:Bbs2 UTSW 8 94082364 missense probably damaging 0.96
R7775:Bbs2 UTSW 8 94089760 critical splice donor site probably null
R7778:Bbs2 UTSW 8 94089760 critical splice donor site probably null
R7824:Bbs2 UTSW 8 94089760 critical splice donor site probably null
R7895:Bbs2 UTSW 8 94081136 missense probably damaging 1.00
R7930:Bbs2 UTSW 8 94069997 missense probably damaging 1.00
R8004:Bbs2 UTSW 8 94082490 missense possibly damaging 0.95
R8084:Bbs2 UTSW 8 94087428 missense probably damaging 1.00
R8305:Bbs2 UTSW 8 94074325 missense probably damaging 1.00
R8545:Bbs2 UTSW 8 94086724 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCACAGGGACATCTTTGGG -3'
(R):5'- ACTGAGTGACTAAGCTGAAGTTAGG -3'

Sequencing Primer
(F):5'- AGGTGTAATTGGTACCCGGAG -3'
(R):5'- AAGCTGAAGTTAGGAGGTGTCTTAC -3'
Posted On2017-03-31