Incidental Mutation 'R5963:St14'
ID471885
Institutional Source Beutler Lab
Gene Symbol St14
Ensembl Gene ENSMUSG00000031995
Gene Namesuppression of tumorigenicity 14 (colon carcinoma)
SynonymsMT-SP1, matriptase, Tmprss14, Prss14, Epithin
MMRRC Submission 044148-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5963 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location31089402-31131853 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 31106557 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150666 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034478] [ENSMUST00000123557] [ENSMUST00000214418]
Predicted Effect probably benign
Transcript: ENSMUST00000034478
SMART Domains Protein: ENSMUSP00000034478
Gene: ENSMUSG00000031995

DomainStartEndE-ValueType
transmembrane domain 55 77 N/A INTRINSIC
Pfam:SEA 88 181 7.9e-17 PFAM
CUB 214 334 4.24e-14 SMART
CUB 340 447 4.37e-25 SMART
LDLa 452 486 2.31e-9 SMART
LDLa 487 523 4.08e-10 SMART
LDLa 524 561 3.98e-13 SMART
LDLa 566 604 1.48e-7 SMART
Tryp_SPc 614 849 1.25e-93 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133904
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148789
Predicted Effect probably benign
Transcript: ENSMUST00000214418
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217404
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.5%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an epithelial-derived, integral membrane serine protease. This protease forms a complex with the Kunitz-type serine protease inhibitor, HAI-1, and is found to be activated by sphingosine 1-phosphate. This protease has been shown to cleave and activate hepatocyte growth factor/scattering factor, and urokinase plasminogen activator, which suggest the function of this protease as an epithelial membrane activator for other proteases and latent growth factors. The expression of this protease has been associated with breast, colon, prostate, and ovarian tumors, which implicates its role in cancer invasion, and metastasis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this locus results in pleiotropic defects affecting the development of the epidermis, hair follicles, and immune system. Mutant mice become dehydrated due to impaired epidermal barrier function and die within days of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg8 A G 7: 97,379,830 K131E probably benign Het
Ank3 T A 10: 69,987,226 L575* probably null Het
Aqr T C 2: 114,126,961 T819A probably damaging Het
Bbs2 A T 8: 94,081,031 S407T probably benign Het
Bmper T A 9: 23,375,593 C272S probably benign Het
Btbd9 C T 17: 30,334,218 probably null Het
C5ar1 A G 7: 16,248,822 V91A possibly damaging Het
Ccdc138 A G 10: 58,575,757 H649R possibly damaging Het
Cfap43 A T 19: 47,745,574 V1451E probably benign Het
Cfap46 T A 7: 139,651,595 M901L probably damaging Het
Cherp G T 8: 72,461,535 probably benign Het
D430041D05Rik C T 2: 104,248,285 V1229I possibly damaging Het
Fat4 A C 3: 39,010,547 D4884A probably damaging Het
Fcrl5 T C 3: 87,444,173 F243L probably damaging Het
Garem1 T A 18: 21,129,430 I776F probably benign Het
Gpr87 T A 3: 59,179,269 R272* probably null Het
Gsdmc A T 15: 63,780,116 probably null Het
Hydin T A 8: 110,494,294 F1441I possibly damaging Het
Ints11 T A 4: 155,872,912 C63* probably null Het
Kdm4b A T 17: 56,399,732 T908S probably damaging Het
Lipn A G 19: 34,081,300 D304G probably damaging Het
Man2a1 T G 17: 64,675,122 N544K probably benign Het
Mapkapk5 G T 5: 121,538,481 H66N probably damaging Het
Mog G A 17: 37,012,348 R233* probably null Het
Mrps24 A T 11: 5,707,481 probably benign Het
Nom1 T C 5: 29,437,770 L423P probably damaging Het
Olfr65 T A 7: 103,906,961 V174E probably benign Het
Pcdha1 T A 18: 36,931,171 V296E probably damaging Het
Pdcd2 T C 17: 15,526,394 K168E possibly damaging Het
Pdcd2 G T 17: 15,526,395 H167Q probably damaging Het
Pla2g12b T A 10: 59,403,958 V63D probably damaging Het
Pnn C T 12: 59,067,831 R56* probably null Het
Primpol T A 8: 46,593,580 E227V possibly damaging Het
Rad54l A T 4: 116,110,387 W233R probably damaging Het
Rims2 A T 15: 39,437,182 D103V probably damaging Het
Rttn T C 18: 89,073,695 S1511P probably benign Het
Sept5 T C 16: 18,624,212 probably null Het
Simc1 T A 13: 54,525,819 I660K possibly damaging Het
Slc15a5 A G 6: 138,079,693 L75P probably damaging Het
Slc9a2 A G 1: 40,682,036 S55G possibly damaging Het
Slit3 C T 11: 35,700,236 R1292C probably damaging Het
Slitrk3 A G 3: 73,050,713 V242A probably benign Het
Tnnt2 T C 1: 135,843,862 probably benign Het
Traf5 G A 1: 192,000,016 T288I probably benign Het
Trerf1 C T 17: 47,314,337 noncoding transcript Het
Vegfc A G 8: 54,181,284 N333D probably benign Het
Vmn1r65 T A 7: 6,008,609 I209F probably damaging Het
Vps51 A G 19: 6,068,290 L725P probably damaging Het
Vps8 T C 16: 21,470,121 I408T possibly damaging Het
Wdr72 T C 9: 74,145,028 Y114H probably damaging Het
Ybx2 A G 11: 69,941,092 E164G probably damaging Het
Zcchc14 A T 8: 121,628,623 probably benign Het
Zfp383 A G 7: 29,915,678 T453A possibly damaging Het
Zfp84 G T 7: 29,776,953 G357C probably damaging Het
Zmynd11 G T 13: 9,695,895 probably benign Het
Other mutations in St14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:St14 APN 9 31103779 missense probably damaging 1.00
IGL01443:St14 APN 9 31100193 nonsense probably null
IGL01816:St14 APN 9 31108267 missense possibly damaging 0.71
IGL02100:St14 APN 9 31100130 splice site probably benign
IGL02494:St14 APN 9 31108645 missense possibly damaging 0.47
IGL02588:St14 APN 9 31090033 splice site probably benign
IGL02663:St14 APN 9 31100382 splice site probably null
IGL02711:St14 APN 9 31089900 missense probably benign 0.05
IGL03130:St14 APN 9 31097071 critical splice donor site probably null
IGL03296:St14 APN 9 31108712 missense probably damaging 0.98
IGL03400:St14 APN 9 31096971 splice site probably benign
R0101:St14 UTSW 9 31097107 missense probably benign 0.23
R0225:St14 UTSW 9 31108284 critical splice acceptor site probably null
R0335:St14 UTSW 9 31091324 splice site probably benign
R0892:St14 UTSW 9 31100428 missense probably benign 0.38
R1334:St14 UTSW 9 31108210 missense probably damaging 1.00
R1487:St14 UTSW 9 31097180 missense probably damaging 1.00
R1521:St14 UTSW 9 31108215 missense probably benign 0.03
R1782:St14 UTSW 9 31100164 missense probably damaging 1.00
R1920:St14 UTSW 9 31089870 missense possibly damaging 0.94
R1921:St14 UTSW 9 31089870 missense possibly damaging 0.94
R1922:St14 UTSW 9 31089870 missense possibly damaging 0.94
R1933:St14 UTSW 9 31106212 missense probably benign 0.00
R2070:St14 UTSW 9 31091373 missense probably damaging 1.00
R2411:St14 UTSW 9 31108234 missense probably benign 0.13
R4152:St14 UTSW 9 31090506 missense probably benign 0.08
R4375:St14 UTSW 9 31090458 missense probably benign 0.02
R4419:St14 UTSW 9 31096928 missense probably damaging 1.00
R4747:St14 UTSW 9 31103757 missense possibly damaging 0.78
R4791:St14 UTSW 9 31095622 missense probably benign 0.27
R4915:St14 UTSW 9 31108664 nonsense probably null
R5056:St14 UTSW 9 31097551 splice site probably null
R5134:St14 UTSW 9 31095583 missense probably benign 0.00
R5241:St14 UTSW 9 31100418 nonsense probably null
R5325:St14 UTSW 9 31096978 splice site probably null
R5644:St14 UTSW 9 31106510 missense probably benign
R5828:St14 UTSW 9 31091507 missense probably damaging 1.00
R5922:St14 UTSW 9 31129904 intron probably benign
R5930:St14 UTSW 9 31103760 missense probably damaging 1.00
R6911:St14 UTSW 9 31106785 missense probably benign 0.00
R6937:St14 UTSW 9 31129660 intron probably null
R6986:St14 UTSW 9 31096549 missense probably damaging 0.98
R7226:St14 UTSW 9 31100152 missense possibly damaging 0.63
R7395:St14 UTSW 9 31096899 missense probably benign 0.29
R7400:St14 UTSW 9 31108275 missense probably benign 0.36
Z1177:St14 UTSW 9 31090507 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTGCGAACTCAGGTAGACAC -3'
(R):5'- TAACATCTGTGGTGGCCTTCC -3'

Sequencing Primer
(F):5'- CACAAGGAAAGGAGCTTTGGACC -3'
(R):5'- TGGCCTTCCGTGAGTGC -3'
Posted On2017-03-31