Incidental Mutation 'R5963:Mrps24'
ID471890
Institutional Source Beutler Lab
Gene Symbol Mrps24
Ensembl Gene ENSMUSG00000020477
Gene Namemitochondrial ribosomal protein S24
Synonyms3110030K20Rik, Rpms24
MMRRC Submission 044148-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R5963 (G1)
Quality Score80.5
Status Validated
Chromosome11
Chromosomal Location5703983-5715680 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 5707481 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000154330]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000020770
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123697
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132874
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149980
Predicted Effect probably benign
Transcript: ENSMUST00000154330
SMART Domains Protein: ENSMUSP00000119535
Gene: ENSMUSG00000020477

DomainStartEndE-ValueType
Pfam:MRP-S24 36 167 1.1e-61 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.5%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein. A pseudogene corresponding to this gene is found on chromosome 11. Read-through transcription exists between this gene and the upstream upregulator of cell proliferation (URGCP) gene. [provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg8 A G 7: 97,379,830 K131E probably benign Het
Ank3 T A 10: 69,987,226 L575* probably null Het
Aqr T C 2: 114,126,961 T819A probably damaging Het
Bbs2 A T 8: 94,081,031 S407T probably benign Het
Bmper T A 9: 23,375,593 C272S probably benign Het
Btbd9 C T 17: 30,334,218 probably null Het
C5ar1 A G 7: 16,248,822 V91A possibly damaging Het
Ccdc138 A G 10: 58,575,757 H649R possibly damaging Het
Cfap43 A T 19: 47,745,574 V1451E probably benign Het
Cfap46 T A 7: 139,651,595 M901L probably damaging Het
Cherp G T 8: 72,461,535 probably benign Het
D430041D05Rik C T 2: 104,248,285 V1229I possibly damaging Het
Fat4 A C 3: 39,010,547 D4884A probably damaging Het
Fcrl5 T C 3: 87,444,173 F243L probably damaging Het
Garem1 T A 18: 21,129,430 I776F probably benign Het
Gpr87 T A 3: 59,179,269 R272* probably null Het
Gsdmc A T 15: 63,780,116 probably null Het
Hydin T A 8: 110,494,294 F1441I possibly damaging Het
Ints11 T A 4: 155,872,912 C63* probably null Het
Kdm4b A T 17: 56,399,732 T908S probably damaging Het
Lipn A G 19: 34,081,300 D304G probably damaging Het
Man2a1 T G 17: 64,675,122 N544K probably benign Het
Mapkapk5 G T 5: 121,538,481 H66N probably damaging Het
Mog G A 17: 37,012,348 R233* probably null Het
Nom1 T C 5: 29,437,770 L423P probably damaging Het
Olfr65 T A 7: 103,906,961 V174E probably benign Het
Pcdha1 T A 18: 36,931,171 V296E probably damaging Het
Pdcd2 T C 17: 15,526,394 K168E possibly damaging Het
Pdcd2 G T 17: 15,526,395 H167Q probably damaging Het
Pla2g12b T A 10: 59,403,958 V63D probably damaging Het
Pnn C T 12: 59,067,831 R56* probably null Het
Primpol T A 8: 46,593,580 E227V possibly damaging Het
Rad54l A T 4: 116,110,387 W233R probably damaging Het
Rims2 A T 15: 39,437,182 D103V probably damaging Het
Rttn T C 18: 89,073,695 S1511P probably benign Het
Sept5 T C 16: 18,624,212 probably null Het
Simc1 T A 13: 54,525,819 I660K possibly damaging Het
Slc15a5 A G 6: 138,079,693 L75P probably damaging Het
Slc9a2 A G 1: 40,682,036 S55G possibly damaging Het
Slit3 C T 11: 35,700,236 R1292C probably damaging Het
Slitrk3 A G 3: 73,050,713 V242A probably benign Het
St14 A T 9: 31,106,557 probably benign Het
Tnnt2 T C 1: 135,843,862 probably benign Het
Traf5 G A 1: 192,000,016 T288I probably benign Het
Trerf1 C T 17: 47,314,337 noncoding transcript Het
Vegfc A G 8: 54,181,284 N333D probably benign Het
Vmn1r65 T A 7: 6,008,609 I209F probably damaging Het
Vps51 A G 19: 6,068,290 L725P probably damaging Het
Vps8 T C 16: 21,470,121 I408T possibly damaging Het
Wdr72 T C 9: 74,145,028 Y114H probably damaging Het
Ybx2 A G 11: 69,941,092 E164G probably damaging Het
Zcchc14 A T 8: 121,628,623 probably benign Het
Zfp383 A G 7: 29,915,678 T453A possibly damaging Het
Zfp84 G T 7: 29,776,953 G357C probably damaging Het
Zmynd11 G T 13: 9,695,895 probably benign Het
Other mutations in Mrps24
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0791:Mrps24 UTSW 11 5704684 missense possibly damaging 0.72
R4060:Mrps24 UTSW 11 5704676 nonsense probably null
R4062:Mrps24 UTSW 11 5704676 nonsense probably null
R4064:Mrps24 UTSW 11 5704676 nonsense probably null
R6598:Mrps24 UTSW 11 5704713 missense probably benign 0.00
R6974:Mrps24 UTSW 11 5704663 missense probably benign 0.00
R7984:Mrps24 UTSW 11 5707495 missense possibly damaging 0.63
Z1176:Mrps24 UTSW 11 5704538 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- ACGTTCAAGAGTGACCCGTG -3'
(R):5'- CCGTTAGTTCCTGCTCTGAG -3'

Sequencing Primer
(F):5'- TCACCTGTGTGCAGCGACAG -3'
(R):5'- CAAGATGGCGTGGTCCG -3'
Posted On2017-03-31