Incidental Mutation 'R5963:Ybx2'
ID471892
Institutional Source Beutler Lab
Gene Symbol Ybx2
Ensembl Gene ENSMUSG00000018554
Gene NameY box protein 2
SynonymsMSY2
MMRRC Submission 044148-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.786) question?
Stock #R5963 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location69935796-69941605 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69941092 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 164 (E164G)
Ref Sequence ENSEMBL: ENSMUSP00000136684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018698] [ENSMUST00000018710] [ENSMUST00000108601] [ENSMUST00000135437] [ENSMUST00000141837] [ENSMUST00000142500] [ENSMUST00000149194] [ENSMUST00000178363] [ENSMUST00000179298]
Predicted Effect probably damaging
Transcript: ENSMUST00000018698
AA Change: E359G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000018698
Gene: ENSMUSG00000018554
AA Change: E359G

DomainStartEndE-ValueType
low complexity region 2 68 N/A INTRINSIC
low complexity region 71 82 N/A INTRINSIC
CSP 96 164 2.54e-21 SMART
low complexity region 173 212 N/A INTRINSIC
low complexity region 220 242 N/A INTRINSIC
low complexity region 274 294 N/A INTRINSIC
low complexity region 317 339 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000018710
SMART Domains Protein: ENSMUSP00000018710
Gene: ENSMUSG00000018566

DomainStartEndE-ValueType
Pfam:MFS_1 24 436 3.9e-16 PFAM
Pfam:Sugar_tr 27 483 1.7e-155 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108601
AA Change: E282G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104242
Gene: ENSMUSG00000018554
AA Change: E282G

DomainStartEndE-ValueType
CSP 19 87 2.54e-21 SMART
low complexity region 96 135 N/A INTRINSIC
low complexity region 143 165 N/A INTRINSIC
low complexity region 197 217 N/A INTRINSIC
low complexity region 240 262 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130377
Predicted Effect probably benign
Transcript: ENSMUST00000135437
SMART Domains Protein: ENSMUSP00000137092
Gene: ENSMUSG00000018566

DomainStartEndE-ValueType
Pfam:Sugar_tr 1 57 5.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141837
SMART Domains Protein: ENSMUSP00000136806
Gene: ENSMUSG00000018566

DomainStartEndE-ValueType
Pfam:MFS_1 24 438 4.7e-17 PFAM
Pfam:Sugar_tr 26 453 6e-140 PFAM
low complexity region 462 478 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142500
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148395
Predicted Effect probably damaging
Transcript: ENSMUST00000149194
AA Change: E164G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000136684
Gene: ENSMUSG00000018554
AA Change: E164G

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
low complexity region 25 47 N/A INTRINSIC
low complexity region 79 99 N/A INTRINSIC
low complexity region 122 144 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152487
Predicted Effect probably benign
Transcript: ENSMUST00000178363
SMART Domains Protein: ENSMUSP00000136455
Gene: ENSMUSG00000018566

DomainStartEndE-ValueType
PDB:4PYP|A 14 50 3e-10 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178809
Predicted Effect probably benign
Transcript: ENSMUST00000179298
SMART Domains Protein: ENSMUSP00000136726
Gene: ENSMUSG00000018566

DomainStartEndE-ValueType
Pfam:Sugar_tr 26 242 6.9e-65 PFAM
Pfam:MFS_1 27 239 2e-10 PFAM
Meta Mutation Damage Score 0.0920 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.5%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleic acid binding protein which is highly expressed in germ cells. The encoded protein binds to a Y-box element in the promoters of certain genes but also binds to mRNA transcribed from these genes. Pseudogenes for this gene are located on chromosome 10 and 15. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous disruption of this gene leads to both male and female infertility. Spermatogenesis terminates in postmeiotic germ cells with no sperm seen in the epididymis and a marked increase of apoptosis during meiosis. Adult females exhibit a few growingfollicles and no corpora lutea. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg8 A G 7: 97,379,830 K131E probably benign Het
Ank3 T A 10: 69,987,226 L575* probably null Het
Aqr T C 2: 114,126,961 T819A probably damaging Het
Bbs2 A T 8: 94,081,031 S407T probably benign Het
Bmper T A 9: 23,375,593 C272S probably benign Het
Btbd9 C T 17: 30,334,218 probably null Het
C5ar1 A G 7: 16,248,822 V91A possibly damaging Het
Ccdc138 A G 10: 58,575,757 H649R possibly damaging Het
Cfap43 A T 19: 47,745,574 V1451E probably benign Het
Cfap46 T A 7: 139,651,595 M901L probably damaging Het
Cherp G T 8: 72,461,535 probably benign Het
D430041D05Rik C T 2: 104,248,285 V1229I possibly damaging Het
Fat4 A C 3: 39,010,547 D4884A probably damaging Het
Fcrl5 T C 3: 87,444,173 F243L probably damaging Het
Garem1 T A 18: 21,129,430 I776F probably benign Het
Gpr87 T A 3: 59,179,269 R272* probably null Het
Gsdmc A T 15: 63,780,116 probably null Het
Hydin T A 8: 110,494,294 F1441I possibly damaging Het
Ints11 T A 4: 155,872,912 C63* probably null Het
Kdm4b A T 17: 56,399,732 T908S probably damaging Het
Lipn A G 19: 34,081,300 D304G probably damaging Het
Man2a1 T G 17: 64,675,122 N544K probably benign Het
Mapkapk5 G T 5: 121,538,481 H66N probably damaging Het
Mog G A 17: 37,012,348 R233* probably null Het
Mrps24 A T 11: 5,707,481 probably benign Het
Nom1 T C 5: 29,437,770 L423P probably damaging Het
Olfr65 T A 7: 103,906,961 V174E probably benign Het
Pcdha1 T A 18: 36,931,171 V296E probably damaging Het
Pdcd2 T C 17: 15,526,394 K168E possibly damaging Het
Pdcd2 G T 17: 15,526,395 H167Q probably damaging Het
Pla2g12b T A 10: 59,403,958 V63D probably damaging Het
Pnn C T 12: 59,067,831 R56* probably null Het
Primpol T A 8: 46,593,580 E227V possibly damaging Het
Rad54l A T 4: 116,110,387 W233R probably damaging Het
Rims2 A T 15: 39,437,182 D103V probably damaging Het
Rttn T C 18: 89,073,695 S1511P probably benign Het
Sept5 T C 16: 18,624,212 probably null Het
Simc1 T A 13: 54,525,819 I660K possibly damaging Het
Slc15a5 A G 6: 138,079,693 L75P probably damaging Het
Slc9a2 A G 1: 40,682,036 S55G possibly damaging Het
Slit3 C T 11: 35,700,236 R1292C probably damaging Het
Slitrk3 A G 3: 73,050,713 V242A probably benign Het
St14 A T 9: 31,106,557 probably benign Het
Tnnt2 T C 1: 135,843,862 probably benign Het
Traf5 G A 1: 192,000,016 T288I probably benign Het
Trerf1 C T 17: 47,314,337 noncoding transcript Het
Vegfc A G 8: 54,181,284 N333D probably benign Het
Vmn1r65 T A 7: 6,008,609 I209F probably damaging Het
Vps51 A G 19: 6,068,290 L725P probably damaging Het
Vps8 T C 16: 21,470,121 I408T possibly damaging Het
Wdr72 T C 9: 74,145,028 Y114H probably damaging Het
Zcchc14 A T 8: 121,628,623 probably benign Het
Zfp383 A G 7: 29,915,678 T453A possibly damaging Het
Zfp84 G T 7: 29,776,953 G357C probably damaging Het
Zmynd11 G T 13: 9,695,895 probably benign Het
Other mutations in Ybx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Ybx2 APN 11 69940730 missense probably damaging 0.97
IGL02720:Ybx2 APN 11 69940331 missense probably benign
IGL02720:Ybx2 APN 11 69940332 missense probably benign 0.09
PIT4515001:Ybx2 UTSW 11 69940398 missense probably benign 0.41
R0158:Ybx2 UTSW 11 69940319 unclassified probably benign
R1697:Ybx2 UTSW 11 69940061 missense probably benign 0.40
R1985:Ybx2 UTSW 11 69936468 splice site probably null
R3969:Ybx2 UTSW 11 69940416 missense probably damaging 0.99
R4209:Ybx2 UTSW 11 69935941 start gained probably benign
R6378:Ybx2 UTSW 11 69940353 missense possibly damaging 0.73
R7325:Ybx2 UTSW 11 69940355 missense probably benign 0.22
R7982:Ybx2 UTSW 11 69940622 missense possibly damaging 0.94
R8310:Ybx2 UTSW 11 69940368 missense probably damaging 0.96
X0062:Ybx2 UTSW 11 69938348 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTATGCAGGCAAGTCAAGC -3'
(R):5'- AAGCCGATGTTTTGATGTCATG -3'

Sequencing Primer
(F):5'- AAGTCAAGCCCAGGGTGC -3'
(R):5'- TGATGTCATGAATTATGGGAAAGTG -3'
Posted On2017-03-31