Incidental Mutation 'R5963:Pnn'
ID471893
Institutional Source Beutler Lab
Gene Symbol Pnn
Ensembl Gene ENSMUSG00000020994
Gene Namepinin
SynonymsD12Ertd512e
MMRRC Submission 044148-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5963 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location59066884-59073998 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 59067831 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 56 (R56*)
Ref Sequence ENSEMBL: ENSMUSP00000021381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021381] [ENSMUST00000219176]
Predicted Effect probably null
Transcript: ENSMUST00000021381
AA Change: R56*
SMART Domains Protein: ENSMUSP00000021381
Gene: ENSMUSG00000020994
AA Change: R56*

DomainStartEndE-ValueType
Pfam:Pinin_SDK_N 1 132 3.7e-61 PFAM
Pfam:Pinin_SDK_memA 136 261 7.8e-38 PFAM
coiled coil region 290 374 N/A INTRINSIC
low complexity region 451 508 N/A INTRINSIC
low complexity region 514 525 N/A INTRINSIC
internal_repeat_1 559 572 9.16e-7 PROSPERO
internal_repeat_1 563 576 9.16e-7 PROSPERO
low complexity region 579 647 N/A INTRINSIC
low complexity region 651 665 N/A INTRINSIC
low complexity region 671 682 N/A INTRINSIC
low complexity region 695 726 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217676
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217773
Predicted Effect probably benign
Transcript: ENSMUST00000219176
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.5%
Validation Efficiency 99% (68/69)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele die prior to implantation. Mice homozygous for a hypomorphic allele show complete perinatal lethality, edema, axial skeletal abnormalities, cardiac outflow tract defects, cleft palate, and impaired development of the dorsal dermis and brown fat tissue. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg8 A G 7: 97,379,830 K131E probably benign Het
Ank3 T A 10: 69,987,226 L575* probably null Het
Aqr T C 2: 114,126,961 T819A probably damaging Het
Bbs2 A T 8: 94,081,031 S407T probably benign Het
Bmper T A 9: 23,375,593 C272S probably benign Het
Btbd9 C T 17: 30,334,218 probably null Het
C5ar1 A G 7: 16,248,822 V91A possibly damaging Het
Ccdc138 A G 10: 58,575,757 H649R possibly damaging Het
Cfap43 A T 19: 47,745,574 V1451E probably benign Het
Cfap46 T A 7: 139,651,595 M901L probably damaging Het
Cherp G T 8: 72,461,535 probably benign Het
D430041D05Rik C T 2: 104,248,285 V1229I possibly damaging Het
Fat4 A C 3: 39,010,547 D4884A probably damaging Het
Fcrl5 T C 3: 87,444,173 F243L probably damaging Het
Garem1 T A 18: 21,129,430 I776F probably benign Het
Gpr87 T A 3: 59,179,269 R272* probably null Het
Gsdmc A T 15: 63,780,116 probably null Het
Hydin T A 8: 110,494,294 F1441I possibly damaging Het
Ints11 T A 4: 155,872,912 C63* probably null Het
Kdm4b A T 17: 56,399,732 T908S probably damaging Het
Lipn A G 19: 34,081,300 D304G probably damaging Het
Man2a1 T G 17: 64,675,122 N544K probably benign Het
Mapkapk5 G T 5: 121,538,481 H66N probably damaging Het
Mog G A 17: 37,012,348 R233* probably null Het
Mrps24 A T 11: 5,707,481 probably benign Het
Nom1 T C 5: 29,437,770 L423P probably damaging Het
Olfr65 T A 7: 103,906,961 V174E probably benign Het
Pcdha1 T A 18: 36,931,171 V296E probably damaging Het
Pdcd2 T C 17: 15,526,394 K168E possibly damaging Het
Pdcd2 G T 17: 15,526,395 H167Q probably damaging Het
Pla2g12b T A 10: 59,403,958 V63D probably damaging Het
Primpol T A 8: 46,593,580 E227V possibly damaging Het
Rad54l A T 4: 116,110,387 W233R probably damaging Het
Rims2 A T 15: 39,437,182 D103V probably damaging Het
Rttn T C 18: 89,073,695 S1511P probably benign Het
Sept5 T C 16: 18,624,212 probably null Het
Simc1 T A 13: 54,525,819 I660K possibly damaging Het
Slc15a5 A G 6: 138,079,693 L75P probably damaging Het
Slc9a2 A G 1: 40,682,036 S55G possibly damaging Het
Slit3 C T 11: 35,700,236 R1292C probably damaging Het
Slitrk3 A G 3: 73,050,713 V242A probably benign Het
St14 A T 9: 31,106,557 probably benign Het
Tnnt2 T C 1: 135,843,862 probably benign Het
Traf5 G A 1: 192,000,016 T288I probably benign Het
Trerf1 C T 17: 47,314,337 noncoding transcript Het
Vegfc A G 8: 54,181,284 N333D probably benign Het
Vmn1r65 T A 7: 6,008,609 I209F probably damaging Het
Vps51 A G 19: 6,068,290 L725P probably damaging Het
Vps8 T C 16: 21,470,121 I408T possibly damaging Het
Wdr72 T C 9: 74,145,028 Y114H probably damaging Het
Ybx2 A G 11: 69,941,092 E164G probably damaging Het
Zcchc14 A T 8: 121,628,623 probably benign Het
Zfp383 A G 7: 29,915,678 T453A possibly damaging Het
Zfp84 G T 7: 29,776,953 G357C probably damaging Het
Zmynd11 G T 13: 9,695,895 probably benign Het
Other mutations in Pnn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02267:Pnn APN 12 59070209 missense probably damaging 1.00
R0350:Pnn UTSW 12 59067117 critical splice donor site probably null
R1853:Pnn UTSW 12 59071613 missense probably damaging 0.99
R1854:Pnn UTSW 12 59071613 missense probably damaging 0.99
R4287:Pnn UTSW 12 59072170 missense possibly damaging 0.86
R4792:Pnn UTSW 12 59072205 missense possibly damaging 0.86
R4812:Pnn UTSW 12 59071618 missense possibly damaging 0.94
R4933:Pnn UTSW 12 59070227 missense probably damaging 1.00
R5541:Pnn UTSW 12 59071930 missense possibly damaging 0.50
R5716:Pnn UTSW 12 59071872 missense probably benign 0.00
R5781:Pnn UTSW 12 59071819 missense probably damaging 0.99
R6877:Pnn UTSW 12 59068767 missense probably damaging 1.00
R6999:Pnn UTSW 12 59070299 critical splice donor site probably null
R7372:Pnn UTSW 12 59068979 missense probably damaging 1.00
R7458:Pnn UTSW 12 59072414 missense unknown
R7535:Pnn UTSW 12 59072137 missense probably benign 0.00
R8171:Pnn UTSW 12 59070437 missense probably damaging 1.00
R8264:Pnn UTSW 12 59072577 missense unknown
Z1177:Pnn UTSW 12 59072799 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GTGGATCTGAAACGGTCATTTTAG -3'
(R):5'- CCCTACCACCAATTACATTCTTAGATG -3'

Sequencing Primer
(F):5'- CTCATGTGTCTGCATAGG -3'
(R):5'- TGGCTGTCCTGGAACTCAC -3'
Posted On2017-03-31