Incidental Mutation 'R5963:Zmynd11'
ID471895
Institutional Source Beutler Lab
Gene Symbol Zmynd11
Ensembl Gene ENSMUSG00000021156
Gene Namezinc finger, MYND domain containing 11
Synonyms2210402G22Rik
MMRRC Submission 044148-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.532) question?
Stock #R5963 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location9684833-9765330 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to T at 9695895 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062658] [ENSMUST00000110633] [ENSMUST00000110634] [ENSMUST00000110635] [ENSMUST00000110636] [ENSMUST00000110637] [ENSMUST00000110638] [ENSMUST00000128658] [ENSMUST00000130151] [ENSMUST00000144642] [ENSMUST00000157035] [ENSMUST00000154994] [ENSMUST00000152725] [ENSMUST00000223421] [ENSMUST00000220996] [ENSMUST00000222475] [ENSMUST00000146059]
Predicted Effect probably benign
Transcript: ENSMUST00000062658
SMART Domains Protein: ENSMUSP00000059767
Gene: ENSMUSG00000021156

DomainStartEndE-ValueType
BROMO 97 203 1.03e-18 SMART
PWWP 224 275 1.96e-21 SMART
low complexity region 318 331 N/A INTRINSIC
low complexity region 351 362 N/A INTRINSIC
coiled coil region 433 473 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110633
SMART Domains Protein: ENSMUSP00000106263
Gene: ENSMUSG00000021156

DomainStartEndE-ValueType
PHD 62 106 4.19e-7 SMART
RING 66 105 8.31e-1 SMART
BROMO 111 217 1.03e-18 SMART
PWWP 238 289 1.96e-21 SMART
low complexity region 332 345 N/A INTRINSIC
low complexity region 418 437 N/A INTRINSIC
coiled coil region 503 543 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110634
SMART Domains Protein: ENSMUSP00000106264
Gene: ENSMUSG00000021156

DomainStartEndE-ValueType
PHD 102 146 4.19e-7 SMART
RING 106 145 8.31e-1 SMART
BROMO 151 257 1.03e-18 SMART
PWWP 278 329 1.96e-21 SMART
low complexity region 372 385 N/A INTRINSIC
low complexity region 405 416 N/A INTRINSIC
coiled coil region 487 527 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110635
SMART Domains Protein: ENSMUSP00000106265
Gene: ENSMUSG00000021156

DomainStartEndE-ValueType
PHD 102 146 4.19e-7 SMART
RING 106 145 8.31e-1 SMART
BROMO 133 226 3.35e-4 SMART
PWWP 247 298 1.96e-21 SMART
low complexity region 341 354 N/A INTRINSIC
low complexity region 374 385 N/A INTRINSIC
coiled coil region 456 496 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110636
SMART Domains Protein: ENSMUSP00000106266
Gene: ENSMUSG00000021156

DomainStartEndE-ValueType
PHD 102 146 4.19e-7 SMART
RING 106 145 8.31e-1 SMART
BROMO 151 257 1.03e-18 SMART
PWWP 278 329 1.96e-21 SMART
low complexity region 372 385 N/A INTRINSIC
low complexity region 405 416 N/A INTRINSIC
coiled coil region 487 527 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110637
SMART Domains Protein: ENSMUSP00000106267
Gene: ENSMUSG00000021156

DomainStartEndE-ValueType
BROMO 97 203 1.03e-18 SMART
PWWP 224 275 1.96e-21 SMART
low complexity region 318 331 N/A INTRINSIC
low complexity region 351 362 N/A INTRINSIC
coiled coil region 433 473 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110638
SMART Domains Protein: ENSMUSP00000106268
Gene: ENSMUSG00000021156

DomainStartEndE-ValueType
BROMO 97 203 1.03e-18 SMART
PWWP 224 275 1.96e-21 SMART
low complexity region 318 331 N/A INTRINSIC
low complexity region 404 423 N/A INTRINSIC
coiled coil region 489 529 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128658
SMART Domains Protein: ENSMUSP00000121574
Gene: ENSMUSG00000021156

DomainStartEndE-ValueType
Blast:BROMO 97 149 8e-32 BLAST
PDB:4N4I|A 99 149 6e-29 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000130151
SMART Domains Protein: ENSMUSP00000118964
Gene: ENSMUSG00000021156

DomainStartEndE-ValueType
PHD 117 161 4.19e-7 SMART
RING 121 160 8.31e-1 SMART
BROMO 166 272 1.03e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138039
Predicted Effect probably benign
Transcript: ENSMUST00000140180
Predicted Effect probably benign
Transcript: ENSMUST00000144642
SMART Domains Protein: ENSMUSP00000117375
Gene: ENSMUSG00000021156

DomainStartEndE-ValueType
PHD 102 146 4.19e-7 SMART
RING 106 145 8.31e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000157035
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222927
Predicted Effect probably benign
Transcript: ENSMUST00000154994
SMART Domains Protein: ENSMUSP00000116635
Gene: ENSMUSG00000021156

DomainStartEndE-ValueType
PHD 102 146 4.19e-7 SMART
RING 106 145 8.31e-1 SMART
BROMO 151 249 1.59e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152725
SMART Domains Protein: ENSMUSP00000118002
Gene: ENSMUSG00000021156

DomainStartEndE-ValueType
PHD 102 146 4.19e-7 SMART
RING 106 145 8.31e-1 SMART
Blast:BROMO 151 203 8e-31 BLAST
PDB:4N4I|A 153 203 2e-27 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000223421
Predicted Effect probably benign
Transcript: ENSMUST00000220996
Predicted Effect probably benign
Transcript: ENSMUST00000222475
Predicted Effect probably benign
Transcript: ENSMUST00000146059
SMART Domains Protein: ENSMUSP00000122133
Gene: ENSMUSG00000021156

DomainStartEndE-ValueType
Blast:BROMO 38 81 1e-23 BLAST
PDB:4N4I|A 59 89 2e-13 PDB
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.5%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was first identified by its ability to bind the adenovirus E1A protein. The protein localizes to the nucleus. It functions as a transcriptional repressor, and expression of E1A inhibits this repression. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg8 A G 7: 97,379,830 K131E probably benign Het
Ank3 T A 10: 69,987,226 L575* probably null Het
Aqr T C 2: 114,126,961 T819A probably damaging Het
Bbs2 A T 8: 94,081,031 S407T probably benign Het
Bmper T A 9: 23,375,593 C272S probably benign Het
Btbd9 C T 17: 30,334,218 probably null Het
C5ar1 A G 7: 16,248,822 V91A possibly damaging Het
Ccdc138 A G 10: 58,575,757 H649R possibly damaging Het
Cfap43 A T 19: 47,745,574 V1451E probably benign Het
Cfap46 T A 7: 139,651,595 M901L probably damaging Het
Cherp G T 8: 72,461,535 probably benign Het
D430041D05Rik C T 2: 104,248,285 V1229I possibly damaging Het
Fat4 A C 3: 39,010,547 D4884A probably damaging Het
Fcrl5 T C 3: 87,444,173 F243L probably damaging Het
Garem1 T A 18: 21,129,430 I776F probably benign Het
Gpr87 T A 3: 59,179,269 R272* probably null Het
Gsdmc A T 15: 63,780,116 probably null Het
Hydin T A 8: 110,494,294 F1441I possibly damaging Het
Ints11 T A 4: 155,872,912 C63* probably null Het
Kdm4b A T 17: 56,399,732 T908S probably damaging Het
Lipn A G 19: 34,081,300 D304G probably damaging Het
Man2a1 T G 17: 64,675,122 N544K probably benign Het
Mapkapk5 G T 5: 121,538,481 H66N probably damaging Het
Mog G A 17: 37,012,348 R233* probably null Het
Mrps24 A T 11: 5,707,481 probably benign Het
Nom1 T C 5: 29,437,770 L423P probably damaging Het
Olfr65 T A 7: 103,906,961 V174E probably benign Het
Pcdha1 T A 18: 36,931,171 V296E probably damaging Het
Pdcd2 T C 17: 15,526,394 K168E possibly damaging Het
Pdcd2 G T 17: 15,526,395 H167Q probably damaging Het
Pla2g12b T A 10: 59,403,958 V63D probably damaging Het
Pnn C T 12: 59,067,831 R56* probably null Het
Primpol T A 8: 46,593,580 E227V possibly damaging Het
Rad54l A T 4: 116,110,387 W233R probably damaging Het
Rims2 A T 15: 39,437,182 D103V probably damaging Het
Rttn T C 18: 89,073,695 S1511P probably benign Het
Sept5 T C 16: 18,624,212 probably null Het
Simc1 T A 13: 54,525,819 I660K possibly damaging Het
Slc15a5 A G 6: 138,079,693 L75P probably damaging Het
Slc9a2 A G 1: 40,682,036 S55G possibly damaging Het
Slit3 C T 11: 35,700,236 R1292C probably damaging Het
Slitrk3 A G 3: 73,050,713 V242A probably benign Het
St14 A T 9: 31,106,557 probably benign Het
Tnnt2 T C 1: 135,843,862 probably benign Het
Traf5 G A 1: 192,000,016 T288I probably benign Het
Trerf1 C T 17: 47,314,337 noncoding transcript Het
Vegfc A G 8: 54,181,284 N333D probably benign Het
Vmn1r65 T A 7: 6,008,609 I209F probably damaging Het
Vps51 A G 19: 6,068,290 L725P probably damaging Het
Vps8 T C 16: 21,470,121 I408T possibly damaging Het
Wdr72 T C 9: 74,145,028 Y114H probably damaging Het
Ybx2 A G 11: 69,941,092 E164G probably damaging Het
Zcchc14 A T 8: 121,628,623 probably benign Het
Zfp383 A G 7: 29,915,678 T453A possibly damaging Het
Zfp84 G T 7: 29,776,953 G357C probably damaging Het
Other mutations in Zmynd11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Zmynd11 APN 13 9689226 missense probably damaging 0.97
IGL00846:Zmynd11 APN 13 9720772 critical splice donor site probably null
IGL01606:Zmynd11 APN 13 9697688 missense probably damaging 1.00
IGL03229:Zmynd11 APN 13 9689565 missense probably damaging 1.00
R1173:Zmynd11 UTSW 13 9689549 missense probably damaging 1.00
R1413:Zmynd11 UTSW 13 9710220 missense probably damaging 1.00
R1813:Zmynd11 UTSW 13 9689580 missense possibly damaging 0.53
R1872:Zmynd11 UTSW 13 9698701 missense possibly damaging 0.88
R2002:Zmynd11 UTSW 13 9689478 splice site probably null
R2991:Zmynd11 UTSW 13 9695822 missense probably damaging 0.99
R4273:Zmynd11 UTSW 13 9697690 missense probably damaging 1.00
R4708:Zmynd11 UTSW 13 9695753 missense probably damaging 0.97
R4718:Zmynd11 UTSW 13 9689567 missense possibly damaging 0.86
R5011:Zmynd11 UTSW 13 9689443 unclassified probably benign
R5151:Zmynd11 UTSW 13 9690917 missense probably damaging 1.00
R6648:Zmynd11 UTSW 13 9713021 missense probably benign 0.11
R7002:Zmynd11 UTSW 13 9694330 missense probably damaging 1.00
R7223:Zmynd11 UTSW 13 9710162 missense probably benign 0.09
R7322:Zmynd11 UTSW 13 9690409 missense possibly damaging 0.53
R7462:Zmynd11 UTSW 13 9698684 missense probably benign 0.29
R7500:Zmynd11 UTSW 13 9735398 missense probably benign 0.00
R7737:Zmynd11 UTSW 13 9695139 missense probably damaging 1.00
R8181:Zmynd11 UTSW 13 9689651 missense probably benign 0.08
R8331:Zmynd11 UTSW 13 9695154 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- ACTGTTGCAGATATTCAACGTG -3'
(R):5'- CTGTTAGGAAGATGGCAGGC -3'

Sequencing Primer
(F):5'- TCAAACTGTACAGAAAGACAAAAAGG -3'
(R):5'- GCATATGTGGCCCTGCTCTG -3'
Posted On2017-03-31