Incidental Mutation 'R5963:Simc1'
ID471896
Institutional Source Beutler Lab
Gene Symbol Simc1
Ensembl Gene ENSMUSG00000043183
Gene NameSUMO-interacting motifs containing 1
Synonyms4732471D19Rik
MMRRC Submission 044148-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R5963 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location54503779-54551290 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 54525819 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 660 (I660K)
Ref Sequence ENSEMBL: ENSMUSP00000113676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118072] [ENSMUST00000121401] [ENSMUST00000138869] [ENSMUST00000159721]
Predicted Effect probably benign
Transcript: ENSMUST00000118072
SMART Domains Protein: ENSMUSP00000112376
Gene: ENSMUSG00000043183

DomainStartEndE-ValueType
low complexity region 11 34 N/A INTRINSIC
low complexity region 167 179 N/A INTRINSIC
low complexity region 378 392 N/A INTRINSIC
low complexity region 425 443 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121401
AA Change: I660K

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113676
Gene: ENSMUSG00000043183
AA Change: I660K

DomainStartEndE-ValueType
low complexity region 11 34 N/A INTRINSIC
low complexity region 173 189 N/A INTRINSIC
low complexity region 222 234 N/A INTRINSIC
low complexity region 249 263 N/A INTRINSIC
internal_repeat_1 268 491 3.21e-17 PROSPERO
internal_repeat_1 579 832 3.21e-17 PROSPERO
low complexity region 852 868 N/A INTRINSIC
low complexity region 1068 1080 N/A INTRINSIC
low complexity region 1279 1293 N/A INTRINSIC
low complexity region 1326 1344 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123852
Predicted Effect probably benign
Transcript: ENSMUST00000138869
SMART Domains Protein: ENSMUSP00000124474
Gene: ENSMUSG00000043183

DomainStartEndE-ValueType
low complexity region 11 34 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150011
Predicted Effect probably benign
Transcript: ENSMUST00000159721
SMART Domains Protein: ENSMUSP00000124921
Gene: ENSMUSG00000043183

DomainStartEndE-ValueType
low complexity region 11 34 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.5%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg8 A G 7: 97,379,830 K131E probably benign Het
Ank3 T A 10: 69,987,226 L575* probably null Het
Aqr T C 2: 114,126,961 T819A probably damaging Het
Bbs2 A T 8: 94,081,031 S407T probably benign Het
Bmper T A 9: 23,375,593 C272S probably benign Het
Btbd9 C T 17: 30,334,218 probably null Het
C5ar1 A G 7: 16,248,822 V91A possibly damaging Het
Ccdc138 A G 10: 58,575,757 H649R possibly damaging Het
Cfap43 A T 19: 47,745,574 V1451E probably benign Het
Cfap46 T A 7: 139,651,595 M901L probably damaging Het
Cherp G T 8: 72,461,535 probably benign Het
D430041D05Rik C T 2: 104,248,285 V1229I possibly damaging Het
Fat4 A C 3: 39,010,547 D4884A probably damaging Het
Fcrl5 T C 3: 87,444,173 F243L probably damaging Het
Garem1 T A 18: 21,129,430 I776F probably benign Het
Gpr87 T A 3: 59,179,269 R272* probably null Het
Gsdmc A T 15: 63,780,116 probably null Het
Hydin T A 8: 110,494,294 F1441I possibly damaging Het
Ints11 T A 4: 155,872,912 C63* probably null Het
Kdm4b A T 17: 56,399,732 T908S probably damaging Het
Lipn A G 19: 34,081,300 D304G probably damaging Het
Man2a1 T G 17: 64,675,122 N544K probably benign Het
Mapkapk5 G T 5: 121,538,481 H66N probably damaging Het
Mog G A 17: 37,012,348 R233* probably null Het
Mrps24 A T 11: 5,707,481 probably benign Het
Nom1 T C 5: 29,437,770 L423P probably damaging Het
Olfr65 T A 7: 103,906,961 V174E probably benign Het
Pcdha1 T A 18: 36,931,171 V296E probably damaging Het
Pdcd2 T C 17: 15,526,394 K168E possibly damaging Het
Pdcd2 G T 17: 15,526,395 H167Q probably damaging Het
Pla2g12b T A 10: 59,403,958 V63D probably damaging Het
Pnn C T 12: 59,067,831 R56* probably null Het
Primpol T A 8: 46,593,580 E227V possibly damaging Het
Rad54l A T 4: 116,110,387 W233R probably damaging Het
Rims2 A T 15: 39,437,182 D103V probably damaging Het
Rttn T C 18: 89,073,695 S1511P probably benign Het
Sept5 T C 16: 18,624,212 probably null Het
Slc15a5 A G 6: 138,079,693 L75P probably damaging Het
Slc9a2 A G 1: 40,682,036 S55G possibly damaging Het
Slit3 C T 11: 35,700,236 R1292C probably damaging Het
Slitrk3 A G 3: 73,050,713 V242A probably benign Het
St14 A T 9: 31,106,557 probably benign Het
Tnnt2 T C 1: 135,843,862 probably benign Het
Traf5 G A 1: 192,000,016 T288I probably benign Het
Trerf1 C T 17: 47,314,337 noncoding transcript Het
Vegfc A G 8: 54,181,284 N333D probably benign Het
Vmn1r65 T A 7: 6,008,609 I209F probably damaging Het
Vps51 A G 19: 6,068,290 L725P probably damaging Het
Vps8 T C 16: 21,470,121 I408T possibly damaging Het
Wdr72 T C 9: 74,145,028 Y114H probably damaging Het
Ybx2 A G 11: 69,941,092 E164G probably damaging Het
Zcchc14 A T 8: 121,628,623 probably benign Het
Zfp383 A G 7: 29,915,678 T453A possibly damaging Het
Zfp84 G T 7: 29,776,953 G357C probably damaging Het
Zmynd11 G T 13: 9,695,895 probably benign Het
Other mutations in Simc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Simc1 APN 13 54525176 missense probably benign 0.27
IGL00813:Simc1 APN 13 54546986 missense probably damaging 0.98
IGL01326:Simc1 APN 13 54524660 missense probably benign 0.00
IGL01587:Simc1 APN 13 54539704 missense probably damaging 1.00
IGL02887:Simc1 APN 13 54525258 missense probably benign 0.04
IGL02977:Simc1 APN 13 54526307 missense probably benign 0.15
IGL03051:Simc1 APN 13 54526223 missense probably benign 0.15
IGL03065:Simc1 APN 13 54537212 missense probably damaging 1.00
IGL03244:Simc1 APN 13 54550629 missense probably benign 0.06
R0158:Simc1 UTSW 13 54524717 missense probably benign 0.00
R0218:Simc1 UTSW 13 54526604 missense probably damaging 1.00
R0241:Simc1 UTSW 13 54550525 missense probably damaging 1.00
R0241:Simc1 UTSW 13 54550525 missense probably damaging 1.00
R0362:Simc1 UTSW 13 54528467 missense probably damaging 1.00
R0464:Simc1 UTSW 13 54537100 nonsense probably null
R0556:Simc1 UTSW 13 54525347 missense probably benign 0.16
R0616:Simc1 UTSW 13 54547032 missense probably benign 0.03
R0686:Simc1 UTSW 13 54525190 missense probably benign 0.31
R0715:Simc1 UTSW 13 54525655 missense possibly damaging 0.49
R0761:Simc1 UTSW 13 54526574 missense probably damaging 1.00
R1335:Simc1 UTSW 13 54525265 intron probably benign
R1344:Simc1 UTSW 13 54550479 missense probably damaging 1.00
R1345:Simc1 UTSW 13 54525247 intron probably benign
R1585:Simc1 UTSW 13 54525258 missense probably benign 0.04
R1633:Simc1 UTSW 13 54525231 missense probably benign 0.05
R1725:Simc1 UTSW 13 54526406 missense probably damaging 0.99
R1826:Simc1 UTSW 13 54524639 missense probably benign 0.00
R1827:Simc1 UTSW 13 54524639 missense probably benign 0.00
R1893:Simc1 UTSW 13 54539715 missense probably damaging 0.99
R2012:Simc1 UTSW 13 54503888 missense probably benign 0.05
R2088:Simc1 UTSW 13 54541534 missense probably damaging 1.00
R2901:Simc1 UTSW 13 54541518 splice site probably null
R2974:Simc1 UTSW 13 54550461 missense probably damaging 1.00
R4238:Simc1 UTSW 13 54526260 nonsense probably null
R4870:Simc1 UTSW 13 54539763 missense probably null 0.73
R4959:Simc1 UTSW 13 54525318 missense possibly damaging 0.49
R5104:Simc1 UTSW 13 54526362 missense probably benign 0.15
R5217:Simc1 UTSW 13 54539896 unclassified probably benign
R5319:Simc1 UTSW 13 54524982 missense probably benign 0.00
R5635:Simc1 UTSW 13 54525404 missense probably benign 0.00
R5660:Simc1 UTSW 13 54547089 missense probably benign 0.01
R5900:Simc1 UTSW 13 54547024 missense probably damaging 1.00
R6036:Simc1 UTSW 13 54524621 missense probably benign 0.01
R6036:Simc1 UTSW 13 54524621 missense probably benign 0.01
R6089:Simc1 UTSW 13 54528490 missense probably benign 0.30
R6271:Simc1 UTSW 13 54539724 missense probably damaging 1.00
R6322:Simc1 UTSW 13 54550569 missense probably damaging 1.00
R6364:Simc1 UTSW 13 54524600 nonsense probably null
R6434:Simc1 UTSW 13 54526664 missense probably benign 0.22
R6627:Simc1 UTSW 13 54547074 missense probably damaging 1.00
R6758:Simc1 UTSW 13 54525548 missense possibly damaging 0.57
R7236:Simc1 UTSW 13 54524796 missense probably benign 0.03
R7297:Simc1 UTSW 13 54525235 intron probably benign
R7359:Simc1 UTSW 13 54503918 missense unknown
R7362:Simc1 UTSW 13 54539704 missense probably damaging 1.00
R7490:Simc1 UTSW 13 54524349 missense possibly damaging 0.84
R7792:Simc1 UTSW 13 54547330 missense probably damaging 1.00
R7855:Simc1 UTSW 13 54524832 missense probably benign 0.03
R7869:Simc1 UTSW 13 54503900 missense unknown
R8293:Simc1 UTSW 13 54526546 missense probably damaging 0.98
R8330:Simc1 UTSW 13 54525364 intron probably benign
R8692:Simc1 UTSW 13 54525380 missense probably benign 0.16
X0023:Simc1 UTSW 13 54541531 missense probably damaging 0.98
Z1177:Simc1 UTSW 13 54524445 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CATCAAGAGATAGGATGCAGTCAC -3'
(R):5'- CTGGTGACTGCATCCTATCC -3'

Sequencing Primer
(F):5'- CCAGGAGGTGTGTCACTGG -3'
(R):5'- ATCCCTTGATGACCGTGGCAC -3'
Posted On2017-03-31