Incidental Mutation 'R5963:Pdcd2'
ID471904
Institutional Source Beutler Lab
Gene Symbol Pdcd2
Ensembl Gene ENSMUSG00000014771
Gene Nameprogrammed cell death 2
SynonymsRP-8
MMRRC Submission 044148-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5963 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location15519208-15527301 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 15526394 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 168 (K168E)
Ref Sequence ENSEMBL: ENSMUSP00000118625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054450] [ENSMUST00000154293] [ENSMUST00000162505]
Predicted Effect possibly damaging
Transcript: ENSMUST00000054450
AA Change: K168E

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000052523
Gene: ENSMUSG00000014771
AA Change: K168E

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
Pfam:zf-MYND 134 171 2.2e-10 PFAM
Pfam:PDCD2_C 188 338 6e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125709
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137233
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139610
Predicted Effect possibly damaging
Transcript: ENSMUST00000154293
AA Change: K168E

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118625
Gene: ENSMUSG00000014771
AA Change: K168E

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
Pfam:zf-MYND 134 171 4.3e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162505
SMART Domains Protein: ENSMUSP00000124317
Gene: ENSMUSG00000014767

DomainStartEndE-ValueType
low complexity region 55 97 N/A INTRINSIC
low complexity region 103 115 N/A INTRINSIC
low complexity region 117 133 N/A INTRINSIC
Pfam:TBP 139 221 1.1e-34 PFAM
Pfam:TBP 229 312 8.5e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232149
Meta Mutation Damage Score 0.2507 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.5%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein expressed in a variety of tissues. Expression of this gene has been shown to be repressed by B-cell CLL/lymphoma 6 (BCL6), a transcriptional repressor required for lymph node germinal center development, suggesting that BCL6 regulates apoptosis by its effects on this protein. Alternative splicing results in multiple transcript variants and pseudogenes have been identified on chromosomes 9 and 12. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality before implantation with most arresting before the blastocyst satge. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg8 A G 7: 97,379,830 K131E probably benign Het
Ank3 T A 10: 69,987,226 L575* probably null Het
Aqr T C 2: 114,126,961 T819A probably damaging Het
Bbs2 A T 8: 94,081,031 S407T probably benign Het
Bmper T A 9: 23,375,593 C272S probably benign Het
Btbd9 C T 17: 30,334,218 probably null Het
C5ar1 A G 7: 16,248,822 V91A possibly damaging Het
Ccdc138 A G 10: 58,575,757 H649R possibly damaging Het
Cfap43 A T 19: 47,745,574 V1451E probably benign Het
Cfap46 T A 7: 139,651,595 M901L probably damaging Het
Cherp G T 8: 72,461,535 probably benign Het
D430041D05Rik C T 2: 104,248,285 V1229I possibly damaging Het
Fat4 A C 3: 39,010,547 D4884A probably damaging Het
Fcrl5 T C 3: 87,444,173 F243L probably damaging Het
Garem1 T A 18: 21,129,430 I776F probably benign Het
Gpr87 T A 3: 59,179,269 R272* probably null Het
Gsdmc A T 15: 63,780,116 probably null Het
Hydin T A 8: 110,494,294 F1441I possibly damaging Het
Ints11 T A 4: 155,872,912 C63* probably null Het
Kdm4b A T 17: 56,399,732 T908S probably damaging Het
Lipn A G 19: 34,081,300 D304G probably damaging Het
Man2a1 T G 17: 64,675,122 N544K probably benign Het
Mapkapk5 G T 5: 121,538,481 H66N probably damaging Het
Mog G A 17: 37,012,348 R233* probably null Het
Mrps24 A T 11: 5,707,481 probably benign Het
Nom1 T C 5: 29,437,770 L423P probably damaging Het
Olfr65 T A 7: 103,906,961 V174E probably benign Het
Pcdha1 T A 18: 36,931,171 V296E probably damaging Het
Pla2g12b T A 10: 59,403,958 V63D probably damaging Het
Pnn C T 12: 59,067,831 R56* probably null Het
Primpol T A 8: 46,593,580 E227V possibly damaging Het
Rad54l A T 4: 116,110,387 W233R probably damaging Het
Rims2 A T 15: 39,437,182 D103V probably damaging Het
Rttn T C 18: 89,073,695 S1511P probably benign Het
Sept5 T C 16: 18,624,212 probably null Het
Simc1 T A 13: 54,525,819 I660K possibly damaging Het
Slc15a5 A G 6: 138,079,693 L75P probably damaging Het
Slc9a2 A G 1: 40,682,036 S55G possibly damaging Het
Slit3 C T 11: 35,700,236 R1292C probably damaging Het
Slitrk3 A G 3: 73,050,713 V242A probably benign Het
St14 A T 9: 31,106,557 probably benign Het
Tnnt2 T C 1: 135,843,862 probably benign Het
Traf5 G A 1: 192,000,016 T288I probably benign Het
Trerf1 C T 17: 47,314,337 noncoding transcript Het
Vegfc A G 8: 54,181,284 N333D probably benign Het
Vmn1r65 T A 7: 6,008,609 I209F probably damaging Het
Vps51 A G 19: 6,068,290 L725P probably damaging Het
Vps8 T C 16: 21,470,121 I408T possibly damaging Het
Wdr72 T C 9: 74,145,028 Y114H probably damaging Het
Ybx2 A G 11: 69,941,092 E164G probably damaging Het
Zcchc14 A T 8: 121,628,623 probably benign Het
Zfp383 A G 7: 29,915,678 T453A possibly damaging Het
Zfp84 G T 7: 29,776,953 G357C probably damaging Het
Zmynd11 G T 13: 9,695,895 probably benign Het
Other mutations in Pdcd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02632:Pdcd2 APN 17 15521792 missense probably damaging 0.99
R0433:Pdcd2 UTSW 17 15526384 missense probably benign 0.37
R1368:Pdcd2 UTSW 17 15526584 missense probably damaging 1.00
R5083:Pdcd2 UTSW 17 15522822 missense possibly damaging 0.50
R5508:Pdcd2 UTSW 17 15521739 missense probably damaging 1.00
R5963:Pdcd2 UTSW 17 15526395 missense probably damaging 1.00
R6944:Pdcd2 UTSW 17 15525370 missense possibly damaging 0.82
R6993:Pdcd2 UTSW 17 15527081 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCATGACCACGGTTAACTACTC -3'
(R):5'- ACGCATTCTACTCCTATGAGCC -3'

Sequencing Primer
(F):5'- CTAGTCGGCCATTACTGGGAAG -3'
(R):5'- TATGAGCCCCCTTCTGAAACAG -3'
Posted On2017-03-31