Incidental Mutation 'R5963:Mog'
ID471907
Institutional Source Beutler Lab
Gene Symbol Mog
Ensembl Gene ENSMUSG00000076439
Gene Namemyelin oligodendrocyte glycoprotein
SynonymsB230317G11Rik
MMRRC Submission 044148-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R5963 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location37010743-37023398 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 37012348 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 233 (R233*)
Ref Sequence ENSEMBL: ENSMUSP00000099726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069250] [ENSMUST00000089968] [ENSMUST00000102665] [ENSMUST00000167275] [ENSMUST00000172527] [ENSMUST00000172540] [ENSMUST00000172580] [ENSMUST00000173588] [ENSMUST00000174524] [ENSMUST00000174672]
Predicted Effect probably benign
Transcript: ENSMUST00000069250
SMART Domains Protein: ENSMUSP00000065811
Gene: ENSMUSG00000036036

DomainStartEndE-ValueType
KRAB 15 75 3.9e-24 SMART
ZnF_C2H2 140 162 1.8e-5 SMART
ZnF_C2H2 168 190 9.1e-6 SMART
low complexity region 195 207 N/A INTRINSIC
ZnF_C2H2 264 286 4.2e-4 SMART
ZnF_C2H2 313 333 9.2e-2 SMART
low complexity region 377 383 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089968
SMART Domains Protein: ENSMUSP00000087414
Gene: ENSMUSG00000036036

DomainStartEndE-ValueType
KRAB 12 72 9.05e-22 SMART
ZnF_C2H2 137 159 4.17e-3 SMART
ZnF_C2H2 165 187 2.09e-3 SMART
low complexity region 192 204 N/A INTRINSIC
ZnF_C2H2 261 283 9.44e-2 SMART
ZnF_C2H2 310 330 2.17e1 SMART
low complexity region 374 380 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102665
AA Change: R233*
SMART Domains Protein: ENSMUSP00000099726
Gene: ENSMUSG00000076439
AA Change: R233*

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
IGv 48 129 2.28e-16 SMART
transmembrane domain 156 178 N/A INTRINSIC
transmembrane domain 209 231 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158194
Predicted Effect probably benign
Transcript: ENSMUST00000167275
SMART Domains Protein: ENSMUSP00000129489
Gene: ENSMUSG00000076439

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
IGv 48 129 2.28e-16 SMART
transmembrane domain 156 178 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172527
SMART Domains Protein: ENSMUSP00000134116
Gene: ENSMUSG00000036036

DomainStartEndE-ValueType
KRAB 15 62 1.87e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172540
SMART Domains Protein: ENSMUSP00000134024
Gene: ENSMUSG00000036036

DomainStartEndE-ValueType
KRAB 12 72 9.05e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172580
SMART Domains Protein: ENSMUSP00000133894
Gene: ENSMUSG00000036036

DomainStartEndE-ValueType
KRAB 12 72 9.05e-22 SMART
ZnF_C2H2 137 159 4.17e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173588
SMART Domains Protein: ENSMUSP00000135655
Gene: ENSMUSG00000036036

DomainStartEndE-ValueType
Blast:KRAB 1 32 3e-14 BLAST
ZnF_C2H2 97 119 4.17e-3 SMART
ZnF_C2H2 125 145 1.36e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174524
SMART Domains Protein: ENSMUSP00000134418
Gene: ENSMUSG00000036036

DomainStartEndE-ValueType
KRAB 15 75 3.8e-24 SMART
ZnF_C2H2 140 162 1.8e-5 SMART
ZnF_C2H2 168 190 8.9e-6 SMART
low complexity region 195 207 N/A INTRINSIC
ZnF_C2H2 264 286 4.1e-4 SMART
ZnF_C2H2 313 333 9e-2 SMART
low complexity region 377 383 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174672
SMART Domains Protein: ENSMUSP00000133821
Gene: ENSMUSG00000036036

DomainStartEndE-ValueType
KRAB 15 75 3.8e-24 SMART
ZnF_C2H2 140 162 1.8e-5 SMART
ZnF_C2H2 168 190 8.9e-6 SMART
low complexity region 195 207 N/A INTRINSIC
ZnF_C2H2 264 286 4.1e-4 SMART
ZnF_C2H2 313 333 9e-2 SMART
low complexity region 377 383 N/A INTRINSIC
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.5%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a membrane protein expressed on the oligodendrocyte cell surface and the outermost surface of myelin sheaths. Due to this localization, it is a primary target antigen involved in immune-mediated demyelination. This protein may be involved in completion and maintenance of the myelin sheath and in cell-cell communication. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: While one line of homozygous mutant mice showed resistance to experimental autoimmune encephalomyelitis (EAE), another showed increased susceptibility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg8 A G 7: 97,379,830 K131E probably benign Het
Ank3 T A 10: 69,987,226 L575* probably null Het
Aqr T C 2: 114,126,961 T819A probably damaging Het
Bbs2 A T 8: 94,081,031 S407T probably benign Het
Bmper T A 9: 23,375,593 C272S probably benign Het
Btbd9 C T 17: 30,334,218 probably null Het
C5ar1 A G 7: 16,248,822 V91A possibly damaging Het
Ccdc138 A G 10: 58,575,757 H649R possibly damaging Het
Cfap43 A T 19: 47,745,574 V1451E probably benign Het
Cfap46 T A 7: 139,651,595 M901L probably damaging Het
Cherp G T 8: 72,461,535 probably benign Het
D430041D05Rik C T 2: 104,248,285 V1229I possibly damaging Het
Fat4 A C 3: 39,010,547 D4884A probably damaging Het
Fcrl5 T C 3: 87,444,173 F243L probably damaging Het
Garem1 T A 18: 21,129,430 I776F probably benign Het
Gpr87 T A 3: 59,179,269 R272* probably null Het
Gsdmc A T 15: 63,780,116 probably null Het
Hydin T A 8: 110,494,294 F1441I possibly damaging Het
Ints11 T A 4: 155,872,912 C63* probably null Het
Kdm4b A T 17: 56,399,732 T908S probably damaging Het
Lipn A G 19: 34,081,300 D304G probably damaging Het
Man2a1 T G 17: 64,675,122 N544K probably benign Het
Mapkapk5 G T 5: 121,538,481 H66N probably damaging Het
Mrps24 A T 11: 5,707,481 probably benign Het
Nom1 T C 5: 29,437,770 L423P probably damaging Het
Olfr65 T A 7: 103,906,961 V174E probably benign Het
Pcdha1 T A 18: 36,931,171 V296E probably damaging Het
Pdcd2 G T 17: 15,526,395 H167Q probably damaging Het
Pdcd2 T C 17: 15,526,394 K168E possibly damaging Het
Pla2g12b T A 10: 59,403,958 V63D probably damaging Het
Pnn C T 12: 59,067,831 R56* probably null Het
Primpol T A 8: 46,593,580 E227V possibly damaging Het
Rad54l A T 4: 116,110,387 W233R probably damaging Het
Rims2 A T 15: 39,437,182 D103V probably damaging Het
Rttn T C 18: 89,073,695 S1511P probably benign Het
Sept5 T C 16: 18,624,212 probably null Het
Simc1 T A 13: 54,525,819 I660K possibly damaging Het
Slc15a5 A G 6: 138,079,693 L75P probably damaging Het
Slc9a2 A G 1: 40,682,036 S55G possibly damaging Het
Slit3 C T 11: 35,700,236 R1292C probably damaging Het
Slitrk3 A G 3: 73,050,713 V242A probably benign Het
St14 A T 9: 31,106,557 probably benign Het
Tnnt2 T C 1: 135,843,862 probably benign Het
Traf5 G A 1: 192,000,016 T288I probably benign Het
Trerf1 C T 17: 47,314,337 noncoding transcript Het
Vegfc A G 8: 54,181,284 N333D probably benign Het
Vmn1r65 T A 7: 6,008,609 I209F probably damaging Het
Vps51 A G 19: 6,068,290 L725P probably damaging Het
Vps8 T C 16: 21,470,121 I408T possibly damaging Het
Wdr72 T C 9: 74,145,028 Y114H probably damaging Het
Ybx2 A G 11: 69,941,092 E164G probably damaging Het
Zcchc14 A T 8: 121,628,623 probably benign Het
Zfp383 A G 7: 29,915,678 T453A possibly damaging Het
Zfp84 G T 7: 29,776,953 G357C probably damaging Het
Zmynd11 G T 13: 9,695,895 probably benign Het
Other mutations in Mog
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Mog APN 17 37017485 splice site probably null
IGL02991:Mog UTSW 17 37023199 start codon destroyed probably null
R0200:Mog UTSW 17 37012419 missense probably damaging 0.97
R0972:Mog UTSW 17 37017532 missense probably benign 0.14
R1565:Mog UTSW 17 37017582 missense possibly damaging 0.73
R3623:Mog UTSW 17 37012446 missense possibly damaging 0.66
R3624:Mog UTSW 17 37012446 missense possibly damaging 0.66
R4079:Mog UTSW 17 37012410 missense probably damaging 1.00
R4772:Mog UTSW 17 37023157 missense unknown
R4944:Mog UTSW 17 37020541 missense probably damaging 0.99
R4991:Mog UTSW 17 37017489 splice site probably null
R5254:Mog UTSW 17 37012372 missense probably benign 0.18
R7257:Mog UTSW 17 37023127 missense unknown
R7498:Mog UTSW 17 37012092 splice site probably null
Predicted Primers PCR Primer
(F):5'- ACATCTCATTAAGTGGTTCTCCG -3'
(R):5'- GTCAATGCATGGCTGAACATAAAC -3'

Sequencing Primer
(F):5'- AAGTGGTTCTCCGTTTTCCTATG -3'
(R):5'- GCCATGTTCACGGACTCTACAG -3'
Posted On2017-03-31