Incidental Mutation 'R5963:Trerf1'
ID471908
Institutional Source Beutler Lab
Gene Symbol Trerf1
Ensembl Gene ENSMUSG00000064043
Gene Nametranscriptional regulating factor 1
SynonymsTrep132, 9430096I18Rik, Trep-132
MMRRC Submission 044148-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.705) question?
Stock #R5963 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location47140875-47361958 bp(+) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) C to T at 47314337 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000077951
SMART Domains Protein: ENSMUSP00000077103
Gene: ENSMUSG00000064043

DomainStartEndE-ValueType
low complexity region 262 279 N/A INTRINSIC
low complexity region 291 342 N/A INTRINSIC
low complexity region 373 384 N/A INTRINSIC
ZnF_C2H2 512 534 1.2e-3 SMART
low complexity region 552 580 N/A INTRINSIC
low complexity region 666 679 N/A INTRINSIC
low complexity region 690 704 N/A INTRINSIC
low complexity region 732 742 N/A INTRINSIC
low complexity region 764 779 N/A INTRINSIC
ELM2 807 863 7.65e-13 SMART
SANT 912 960 2.18e-5 SMART
coiled coil region 981 1005 N/A INTRINSIC
ZnF_C2H2 1039 1063 2.75e-3 SMART
low complexity region 1092 1106 N/A INTRINSIC
ZnF_C2H2 1112 1134 1.1e-2 SMART
low complexity region 1135 1156 N/A INTRINSIC
low complexity region 1182 1200 N/A INTRINSIC
low complexity region 1208 1222 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188730
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188947
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190020
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190080
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191153
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.5%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc-finger transcriptional regulating protein which interacts with CBP/p300 to regulate the human gene CYP11A1. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg8 A G 7: 97,379,830 K131E probably benign Het
Ank3 T A 10: 69,987,226 L575* probably null Het
Aqr T C 2: 114,126,961 T819A probably damaging Het
Bbs2 A T 8: 94,081,031 S407T probably benign Het
Bmper T A 9: 23,375,593 C272S probably benign Het
Btbd9 C T 17: 30,334,218 probably null Het
C5ar1 A G 7: 16,248,822 V91A possibly damaging Het
Ccdc138 A G 10: 58,575,757 H649R possibly damaging Het
Cfap43 A T 19: 47,745,574 V1451E probably benign Het
Cfap46 T A 7: 139,651,595 M901L probably damaging Het
Cherp G T 8: 72,461,535 probably benign Het
D430041D05Rik C T 2: 104,248,285 V1229I possibly damaging Het
Fat4 A C 3: 39,010,547 D4884A probably damaging Het
Fcrl5 T C 3: 87,444,173 F243L probably damaging Het
Garem1 T A 18: 21,129,430 I776F probably benign Het
Gpr87 T A 3: 59,179,269 R272* probably null Het
Gsdmc A T 15: 63,780,116 probably null Het
Hydin T A 8: 110,494,294 F1441I possibly damaging Het
Ints11 T A 4: 155,872,912 C63* probably null Het
Kdm4b A T 17: 56,399,732 T908S probably damaging Het
Lipn A G 19: 34,081,300 D304G probably damaging Het
Man2a1 T G 17: 64,675,122 N544K probably benign Het
Mapkapk5 G T 5: 121,538,481 H66N probably damaging Het
Mog G A 17: 37,012,348 R233* probably null Het
Mrps24 A T 11: 5,707,481 probably benign Het
Nom1 T C 5: 29,437,770 L423P probably damaging Het
Olfr65 T A 7: 103,906,961 V174E probably benign Het
Pcdha1 T A 18: 36,931,171 V296E probably damaging Het
Pdcd2 G T 17: 15,526,395 H167Q probably damaging Het
Pdcd2 T C 17: 15,526,394 K168E possibly damaging Het
Pla2g12b T A 10: 59,403,958 V63D probably damaging Het
Pnn C T 12: 59,067,831 R56* probably null Het
Primpol T A 8: 46,593,580 E227V possibly damaging Het
Rad54l A T 4: 116,110,387 W233R probably damaging Het
Rims2 A T 15: 39,437,182 D103V probably damaging Het
Rttn T C 18: 89,073,695 S1511P probably benign Het
Sept5 T C 16: 18,624,212 probably null Het
Simc1 T A 13: 54,525,819 I660K possibly damaging Het
Slc15a5 A G 6: 138,079,693 L75P probably damaging Het
Slc9a2 A G 1: 40,682,036 S55G possibly damaging Het
Slit3 C T 11: 35,700,236 R1292C probably damaging Het
Slitrk3 A G 3: 73,050,713 V242A probably benign Het
St14 A T 9: 31,106,557 probably benign Het
Tnnt2 T C 1: 135,843,862 probably benign Het
Traf5 G A 1: 192,000,016 T288I probably benign Het
Vegfc A G 8: 54,181,284 N333D probably benign Het
Vmn1r65 T A 7: 6,008,609 I209F probably damaging Het
Vps51 A G 19: 6,068,290 L725P probably damaging Het
Vps8 T C 16: 21,470,121 I408T possibly damaging Het
Wdr72 T C 9: 74,145,028 Y114H probably damaging Het
Ybx2 A G 11: 69,941,092 E164G probably damaging Het
Zcchc14 A T 8: 121,628,623 probably benign Het
Zfp383 A G 7: 29,915,678 T453A possibly damaging Het
Zfp84 G T 7: 29,776,953 G357C probably damaging Het
Zmynd11 G T 13: 9,695,895 probably benign Het
Other mutations in Trerf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01610:Trerf1 APN 17 47319575 unclassified noncoding transcript
IGL01753:Trerf1 APN 17 47315436 exon noncoding transcript
IGL02172:Trerf1 APN 17 47317817 exon noncoding transcript
IGL02266:Trerf1 APN 17 47315405 exon noncoding transcript
IGL02370:Trerf1 APN 17 47314461 exon noncoding transcript
IGL02613:Trerf1 APN 17 47348840 exon noncoding transcript
R0179:Trerf1 UTSW 17 47316662 critical splice donor site noncoding transcript
R0284:Trerf1 UTSW 17 47319545 unclassified noncoding transcript
R0359:Trerf1 UTSW 17 47341136 exon noncoding transcript
R0689:Trerf1 UTSW 17 47319374 unclassified noncoding transcript
R1460:Trerf1 UTSW 17 47317845 exon noncoding transcript
R1727:Trerf1 UTSW 17 47341166 exon noncoding transcript
R4222:Trerf1 UTSW 17 47314801 exon noncoding transcript
R4562:Trerf1 UTSW 17 47327071 exon noncoding transcript
R4770:Trerf1 UTSW 17 47319655 unclassified noncoding transcript
R5366:Trerf1 UTSW 17 47315190 exon noncoding transcript
R5919:Trerf1 UTSW 17 47323282 unclassified noncoding transcript
R5975:Trerf1 UTSW 17 47314271 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- GGTGGTGAGAACCTCTTCTATC -3'
(R):5'- GGGTGAAAGAGTCCAGCTTG -3'

Sequencing Primer
(F):5'- GTGGTGAGAACCTCTTCTATCAACAG -3'
(R):5'- GAGTCCAGCTTGTGCAAAAC -3'
Posted On2017-03-31