Mutagenetix > Incidental Mutation

Incidental Mutation 'R5963:Garem1'

471911

Institutional Source

Beutler Lab

Gene Symbol

Garem1

Ensembl Gene

ENSMUSG00000042680

Gene Name

GRB2 associated regulator of MAPK1 subtype 1

Synonyms

Garem, Fam59a, LOC381126

MMRRC Submission

044148-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.197) question?

Stock #

R5963 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

21127201-21300138 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 21129430 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 776 (I776F)

Ref Sequence

ENSEMBL: ENSMUSP00000048914 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049260]

AlphaFold

Q3UFT3

Predicted Effect

probably benign
Transcript: ENSMUST00000049260
AA Change: I776F

PolyPhen 2 Score 0.447 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000048914
Gene: ENSMUSG00000042680
AA Change: I776F

Domain	Start	End	E-Value	Type
Pfam:CABIT	32	318	3.4e-79	PFAM
low complexity region	484	499	N/A	INTRINSIC
low complexity region	512	518	N/A	INTRINSIC
PDB:2DKZ\|A	795	874	2e-40	PDB
Blast:SAM	808	875	2e-36	BLAST
SCOP:d1kw4a_	812	873	4e-4	SMART

Meta Mutation Damage Score

0.0614

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 92.5%

Validation Efficiency

99% (68/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adaptor protein which functions in the epidermal growth factor (EGF) receptor-mediated signaling pathway. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alg8	A	G	7: 97,379,830	K131E	probably benign	Het
Ank3	T	A	10: 69,987,226	L575*	probably null	Het
Aqr	T	C	2: 114,126,961	T819A	probably damaging	Het
Bbs2	A	T	8: 94,081,031	S407T	probably benign	Het
Bmper	T	A	9: 23,375,593	C272S	probably benign	Het
Btbd9	C	T	17: 30,334,218		probably null	Het
C5ar1	A	G	7: 16,248,822	V91A	possibly damaging	Het
Ccdc138	A	G	10: 58,575,757	H649R	possibly damaging	Het
Cfap43	A	T	19: 47,745,574	V1451E	probably benign	Het
Cfap46	T	A	7: 139,651,595	M901L	probably damaging	Het
Cherp	G	T	8: 72,461,535		probably benign	Het
D430041D05Rik	C	T	2: 104,248,285	V1229I	possibly damaging	Het
Fat4	A	C	3: 39,010,547	D4884A	probably damaging	Het
Fcrl5	T	C	3: 87,444,173	F243L	probably damaging	Het
Gpr87	T	A	3: 59,179,269	R272*	probably null	Het
Gsdmc	A	T	15: 63,780,116		probably null	Het
Hydin	T	A	8: 110,494,294	F1441I	possibly damaging	Het
Ints11	T	A	4: 155,872,912	C63*	probably null	Het
Kdm4b	A	T	17: 56,399,732	T908S	probably damaging	Het
Lipn	A	G	19: 34,081,300	D304G	probably damaging	Het
Man2a1	T	G	17: 64,675,122	N544K	probably benign	Het
Mapkapk5	G	T	5: 121,538,481	H66N	probably damaging	Het
Mog	G	A	17: 37,012,348	R233*	probably null	Het
Mrps24	A	T	11: 5,707,481		probably benign	Het
Nom1	T	C	5: 29,437,770	L423P	probably damaging	Het
Olfr65	T	A	7: 103,906,961	V174E	probably benign	Het
Pcdha1	T	A	18: 36,931,171	V296E	probably damaging	Het
Pdcd2	T	C	17: 15,526,394	K168E	possibly damaging	Het
Pdcd2	G	T	17: 15,526,395	H167Q	probably damaging	Het
Pla2g12b	T	A	10: 59,403,958	V63D	probably damaging	Het
Pnn	C	T	12: 59,067,831	R56*	probably null	Het
Primpol	T	A	8: 46,593,580	E227V	possibly damaging	Het
Rad54l	A	T	4: 116,110,387	W233R	probably damaging	Het
Rims2	A	T	15: 39,437,182	D103V	probably damaging	Het
Rttn	T	C	18: 89,073,695	S1511P	probably benign	Het
Sept5	T	C	16: 18,624,212		probably null	Het
Simc1	T	A	13: 54,525,819	I660K	possibly damaging	Het
Slc15a5	A	G	6: 138,079,693	L75P	probably damaging	Het
Slc9a2	A	G	1: 40,682,036	S55G	possibly damaging	Het
Slit3	C	T	11: 35,700,236	R1292C	probably damaging	Het
Slitrk3	A	G	3: 73,050,713	V242A	probably benign	Het
St14	A	T	9: 31,106,557		probably benign	Het
Tnnt2	T	C	1: 135,843,862		probably benign	Het
Traf5	G	A	1: 192,000,016	T288I	probably benign	Het
Trerf1	C	T	17: 47,314,337		noncoding transcript	Het
Vegfc	A	G	8: 54,181,284	N333D	probably benign	Het
Vmn1r65	T	A	7: 6,008,609	I209F	probably damaging	Het
Vps51	A	G	19: 6,068,290	L725P	probably damaging	Het
Vps8	T	C	16: 21,470,121	I408T	possibly damaging	Het
Wdr72	T	C	9: 74,145,028	Y114H	probably damaging	Het
Ybx2	A	G	11: 69,941,092	E164G	probably damaging	Het
Zcchc14	A	T	8: 121,628,623		probably benign	Het
Zfp383	A	G	7: 29,915,678	T453A	possibly damaging	Het
Zfp84	G	T	7: 29,776,953	G357C	probably damaging	Het
Zmynd11	G	T	13: 9,695,895		probably benign	Het

Other mutations in Garem1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00504:Garem1	APN	18	21148657	missense	probably damaging	1.00
IGL01588:Garem1	APN	18	21129797	missense	probably damaging	0.99
IGL02171:Garem1	APN	18	21129241	missense	probably damaging	0.98
IGL02270:Garem1	APN	18	21148450	missense	probably damaging	1.00
IGL03149:Garem1	APN	18	21131466	missense	probably damaging	1.00
R0136:Garem1	UTSW	18	21129991	missense	probably damaging	0.96
R0285:Garem1	UTSW	18	21129612	missense	probably benign
R0361:Garem1	UTSW	18	21299744	nonsense	probably null
R1068:Garem1	UTSW	18	21168755	missense	probably benign	0.00
R1537:Garem1	UTSW	18	21168874	splice site	probably null
R1726:Garem1	UTSW	18	21148262	missense	probably damaging	0.99
R1826:Garem1	UTSW	18	21129452	missense	probably benign	0.00
R2140:Garem1	UTSW	18	21129374	missense	probably damaging	1.00
R3714:Garem1	UTSW	18	21148890	missense	probably damaging	1.00
R3937:Garem1	UTSW	18	21148806	nonsense	probably null
R4362:Garem1	UTSW	18	21236115	missense	possibly damaging	0.62
R4441:Garem1	UTSW	18	21168750	missense	possibly damaging	0.92
R4747:Garem1	UTSW	18	21129943	missense	probably benign
R4814:Garem1	UTSW	18	21148116	missense	probably damaging	1.00
R4831:Garem1	UTSW	18	21129768	missense	probably benign	0.01
R4838:Garem1	UTSW	18	21147893	missense	probably benign	0.00
R5805:Garem1	UTSW	18	21148435	missense	probably benign	0.04
R5982:Garem1	UTSW	18	21148351	missense	possibly damaging	0.64
R6134:Garem1	UTSW	18	21129824	missense	probably benign	0.00
R6242:Garem1	UTSW	18	21129172	missense	possibly damaging	0.72
R6453:Garem1	UTSW	18	21148739	missense	probably damaging	0.99
R6485:Garem1	UTSW	18	21129837	missense	probably benign	0.00
R6596:Garem1	UTSW	18	21148739	missense	probably damaging	0.99
R6662:Garem1	UTSW	18	21148247	missense	probably benign	0.45
R6883:Garem1	UTSW	18	21129712	missense	probably benign
R6937:Garem1	UTSW	18	21147770	missense	probably benign	0.00
R7027:Garem1	UTSW	18	21129994	missense	probably benign
R7256:Garem1	UTSW	18	21148754	missense	probably damaging	1.00
R7534:Garem1	UTSW	18	21299916	start gained	probably benign
R7620:Garem1	UTSW	18	21129841	missense	probably benign
R7869:Garem1	UTSW	18	21299700	missense	probably damaging	1.00
R7963:Garem1	UTSW	18	21148787	missense	probably damaging	0.98
R8058:Garem1	UTSW	18	21148564	missense	probably damaging	1.00
R8953:Garem1	UTSW	18	21131331	critical splice donor site	probably null
R9273:Garem1	UTSW	18	21148217	missense	probably damaging	0.99
R9411:Garem1	UTSW	18	21236000	critical splice donor site	probably null
R9475:Garem1	UTSW	18	21148313	missense	probably benign	0.00
Z1176:Garem1	UTSW	18	21129792	missense	probably damaging	1.00
Z1176:Garem1	UTSW	18	21148325	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTCAGTGACAAAGAAGGCTATGAC -3'
(R):5'- GAGAACTCCGAGGACAACTC -3'

Sequencing Primer
(F):5'- AAGGCTATGACGTCTTCAGAC -3'
(R):5'- AGGACAACTCCTTTGCAGCTG -3'

Posted On

2017-03-31