Incidental Mutation 'R5963:Pcdha1'
ID471912
Institutional Source Beutler Lab
Gene Symbol Pcdha1
Ensembl Gene ENSMUSG00000103442
Gene Nameprotocadherin alpha 1
Synonyms
MMRRC Submission 044148-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5963 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location36930184-37187661 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 36931171 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 296 (V296E)
Ref Sequence ENSEMBL: ENSMUSP00000142308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070797] [ENSMUST00000193839]
Predicted Effect probably damaging
Transcript: ENSMUST00000070797
AA Change: V296E

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000068828
Gene: ENSMUSG00000103442
AA Change: V296E

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Pfam:Cadherin_tail 797 931 5.3e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192440
Predicted Effect probably damaging
Transcript: ENSMUST00000193839
AA Change: V296E

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142308
Gene: ENSMUSG00000103442
AA Change: V296E

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.5%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin alpha gene cluster, one of three related gene clusters tandemly linked on chromosome five that demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The alpha gene cluster is composed of 15 cadherin superfamily genes related to the mouse CNR genes and consists of 13 highly similar and 2 more distantly related coding sequences. The tandem array of 15 N-terminal exons, or variable exons, are followed by downstream C-terminal exons, or constant exons, which are shared by all genes in the cluster. The large, uninterrupted N-terminal exons each encode six cadherin ectodomains while the C-terminal exons encode the cytoplasmic domain. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins that most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been observed and additional variants have been suggested but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg8 A G 7: 97,379,830 K131E probably benign Het
Ank3 T A 10: 69,987,226 L575* probably null Het
Aqr T C 2: 114,126,961 T819A probably damaging Het
Bbs2 A T 8: 94,081,031 S407T probably benign Het
Bmper T A 9: 23,375,593 C272S probably benign Het
Btbd9 C T 17: 30,334,218 probably null Het
C5ar1 A G 7: 16,248,822 V91A possibly damaging Het
Ccdc138 A G 10: 58,575,757 H649R possibly damaging Het
Cfap43 A T 19: 47,745,574 V1451E probably benign Het
Cfap46 T A 7: 139,651,595 M901L probably damaging Het
Cherp G T 8: 72,461,535 probably benign Het
D430041D05Rik C T 2: 104,248,285 V1229I possibly damaging Het
Fat4 A C 3: 39,010,547 D4884A probably damaging Het
Fcrl5 T C 3: 87,444,173 F243L probably damaging Het
Garem1 T A 18: 21,129,430 I776F probably benign Het
Gpr87 T A 3: 59,179,269 R272* probably null Het
Gsdmc A T 15: 63,780,116 probably null Het
Hydin T A 8: 110,494,294 F1441I possibly damaging Het
Ints11 T A 4: 155,872,912 C63* probably null Het
Kdm4b A T 17: 56,399,732 T908S probably damaging Het
Lipn A G 19: 34,081,300 D304G probably damaging Het
Man2a1 T G 17: 64,675,122 N544K probably benign Het
Mapkapk5 G T 5: 121,538,481 H66N probably damaging Het
Mog G A 17: 37,012,348 R233* probably null Het
Mrps24 A T 11: 5,707,481 probably benign Het
Nom1 T C 5: 29,437,770 L423P probably damaging Het
Olfr65 T A 7: 103,906,961 V174E probably benign Het
Pdcd2 T C 17: 15,526,394 K168E possibly damaging Het
Pdcd2 G T 17: 15,526,395 H167Q probably damaging Het
Pla2g12b T A 10: 59,403,958 V63D probably damaging Het
Pnn C T 12: 59,067,831 R56* probably null Het
Primpol T A 8: 46,593,580 E227V possibly damaging Het
Rad54l A T 4: 116,110,387 W233R probably damaging Het
Rims2 A T 15: 39,437,182 D103V probably damaging Het
Rttn T C 18: 89,073,695 S1511P probably benign Het
Sept5 T C 16: 18,624,212 probably null Het
Simc1 T A 13: 54,525,819 I660K possibly damaging Het
Slc15a5 A G 6: 138,079,693 L75P probably damaging Het
Slc9a2 A G 1: 40,682,036 S55G possibly damaging Het
Slit3 C T 11: 35,700,236 R1292C probably damaging Het
Slitrk3 A G 3: 73,050,713 V242A probably benign Het
St14 A T 9: 31,106,557 probably benign Het
Tnnt2 T C 1: 135,843,862 probably benign Het
Traf5 G A 1: 192,000,016 T288I probably benign Het
Trerf1 C T 17: 47,314,337 noncoding transcript Het
Vegfc A G 8: 54,181,284 N333D probably benign Het
Vmn1r65 T A 7: 6,008,609 I209F probably damaging Het
Vps51 A G 19: 6,068,290 L725P probably damaging Het
Vps8 T C 16: 21,470,121 I408T possibly damaging Het
Wdr72 T C 9: 74,145,028 Y114H probably damaging Het
Ybx2 A G 11: 69,941,092 E164G probably damaging Het
Zcchc14 A T 8: 121,628,623 probably benign Het
Zfp383 A G 7: 29,915,678 T453A possibly damaging Het
Zfp84 G T 7: 29,776,953 G357C probably damaging Het
Zmynd11 G T 13: 9,695,895 probably benign Het
Other mutations in Pcdha1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00714:Pcdha1 APN 18 36932175 missense probably damaging 0.99
R0062:Pcdha1 UTSW 18 37006628 missense probably benign 0.08
R0108:Pcdha1 UTSW 18 36998756 missense probably benign
R0543:Pcdha1 UTSW 18 37185068 missense probably damaging 1.00
R1599:Pcdha1 UTSW 18 37185237 missense probably damaging 1.00
R1717:Pcdha1 UTSW 18 36932184 missense probably benign 0.01
R2301:Pcdha1 UTSW 18 37156183 missense probably damaging 1.00
R3038:Pcdha1 UTSW 18 36931011 missense probably damaging 1.00
R3086:Pcdha1 UTSW 18 36930948 missense possibly damaging 0.95
R3693:Pcdha1 UTSW 18 36932308 missense possibly damaging 0.95
R3783:Pcdha1 UTSW 18 36930802 missense probably damaging 1.00
R3881:Pcdha1 UTSW 18 36931401 missense possibly damaging 0.91
R4012:Pcdha1 UTSW 18 36931136 missense probably benign 0.02
R4540:Pcdha1 UTSW 18 36931627 missense probably damaging 1.00
R4597:Pcdha1 UTSW 18 36931906 missense possibly damaging 0.64
R4678:Pcdha1 UTSW 18 36930912 missense probably benign 0.00
R4998:Pcdha1 UTSW 18 36932416 missense probably damaging 1.00
R5466:Pcdha1 UTSW 18 36932259 missense possibly damaging 0.73
R5518:Pcdha1 UTSW 18 36932362 missense probably benign 0.23
R5673:Pcdha1 UTSW 18 36930673 missense probably damaging 1.00
R5925:Pcdha1 UTSW 18 36930671 missense probably damaging 1.00
R5942:Pcdha1 UTSW 18 36930391 missense probably damaging 1.00
R6034:Pcdha1 UTSW 18 36930598 missense probably damaging 1.00
R6034:Pcdha1 UTSW 18 36930598 missense probably damaging 1.00
R6107:Pcdha1 UTSW 18 36932301 missense probably benign 0.00
R6329:Pcdha1 UTSW 18 36932248 missense probably damaging 1.00
R6479:Pcdha1 UTSW 18 36931456 missense probably benign 0.28
R6503:Pcdha1 UTSW 18 36931671 missense probably damaging 1.00
R6907:Pcdha1 UTSW 18 36931071 missense probably benign 0.01
R7011:Pcdha1 UTSW 18 36930535 missense probably damaging 1.00
R7030:Pcdha1 UTSW 18 37159273 missense probably damaging 0.97
R7314:Pcdha1 UTSW 18 36931500 missense probably damaging 0.99
R7343:Pcdha1 UTSW 18 36930649 missense probably damaging 1.00
R7699:Pcdha1 UTSW 18 36931062 missense probably damaging 0.98
R7700:Pcdha1 UTSW 18 36931062 missense probably damaging 0.98
R7768:Pcdha1 UTSW 18 36932167 missense probably damaging 1.00
R7780:Pcdha1 UTSW 18 36932458 missense probably benign 0.28
R7800:Pcdha1 UTSW 18 36931373 missense probably damaging 1.00
R7917:Pcdha1 UTSW 18 36932201 missense possibly damaging 0.64
R8325:Pcdha1 UTSW 18 36930814 missense possibly damaging 0.47
R8699:Pcdha1 UTSW 18 36931023 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTAATGACAACGCCCCACTG -3'
(R):5'- GGACACCTTGATGAGTGCGATG -3'

Sequencing Primer
(F):5'- TGTTTGACCAGGCCATCTACAGAG -3'
(R):5'- CAAGGATGTGATCGACAGCTCTG -3'
Posted On2017-03-31