Mutagenetix > Incidental Mutations

Incidental Mutation 'R5964:Agl'

471930

Institutional Source

Beutler Lab

Gene Symbol

Agl

Ensembl Gene

ENSMUSG00000033400

Gene Name

amylo-1,6-glucosidase, 4-alpha-glucanotransferase

Synonyms

9430004C13Rik, 9630046L06Rik, 1110061O17Rik

MMRRC Submission

044149-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.275) question?

Stock #

R5964 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

116739999-116808166 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 116793774 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 44 (V44A)

Ref Sequence

ENSEMBL: ENSMUSP00000124149 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040603] [ENSMUST00000159670] [ENSMUST00000159742] [ENSMUST00000161336] [ENSMUST00000162792]

Predicted Effect

probably damaging
Transcript: ENSMUST00000040603
AA Change: V44A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000044012
Gene: ENSMUSG00000033400
AA Change: V44A

Domain	Start	End	E-Value	Type
Pfam:hGDE_N	31	116	4.8e-24	PFAM
Pfam:hDGE_amylase	120	550	9.6e-167	PFAM
Pfam:hGDE_central	697	974	2e-90	PFAM
Pfam:GDE_C	1044	1527	8.5e-145	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000159670
AA Change: V44A

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000124840
Gene: ENSMUSG00000033400
AA Change: V44A

Domain	Start	End	E-Value	Type
Pfam:hGDE_N	30	117	7.9e-30	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000159742
AA Change: V44A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000143582
Gene: ENSMUSG00000033400
AA Change: V44A

Domain	Start	End	E-Value	Type
Pfam:hGDE_N	31	116	2.1e-20	PFAM
Pfam:hDGE_amylase	120	550	7.8e-164	PFAM
Pfam:hGDE_central	697	974	6.2e-87	PFAM
Pfam:GDE_C	1043	1279	6.7e-61	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000161336
AA Change: V44A

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000123877
Gene: ENSMUSG00000033400
AA Change: V44A

Domain	Start	End	E-Value	Type
Pfam:hGDE_N	30	117	2.1e-29	PFAM
Pfam:hDGE_amylase	120	230	3.7e-43	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162040

Predicted Effect

probably damaging
Transcript: ENSMUST00000162792
AA Change: V44A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000124149
Gene: ENSMUSG00000033400
AA Change: V44A

Domain	Start	End	E-Value	Type
Pfam:hGDE_N	30	117	4e-28	PFAM
Pfam:hDGE_amylase	120	550	1.4e-167	PFAM
Pfam:hGDE_central	697	975	5.6e-95	PFAM
Pfam:GDE_C	1061	1527	1.1e-137	PFAM

Meta Mutation Damage Score

0.4309

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.2%

Validation Efficiency

96% (87/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the glycogen debrancher enzyme which is involved in glycogen degradation. This enzyme has two independent catalytic activities which occur at different sites on the protein: a 4-alpha-glucotransferase activity and a amylo-1,6-glucosidase activity. Mutations in this gene are associated with glycogen storage disease although a wide range of enzymatic and clinical variability occurs which may be due to tissue-specific alternative splicing. Alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to hypoglycemia, altered blood biochemistry, severe hepatomegaly, glycogen accumulation in the liver, heart, skeletal muscle and other tissues, motor impairment, and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam15	G	A	3: 89,343,567	Q581*	probably null	Het
Alpk3	T	A	7: 81,092,260	D608E	possibly damaging	Het
Aspm	C	A	1: 139,455,227		probably benign	Het
Bbs2	T	C	8: 94,068,367	N692S	probably benign	Het
Bend4	A	G	5: 67,417,818	I240T	probably benign	Het
Casp8	G	T	1: 58,833,736	R277L	possibly damaging	Het
Ccdc61	A	T	7: 18,900,940	I123N	probably damaging	Het
Ccr9	T	G	9: 123,779,434	I60M	probably benign	Het
Cd163	T	A	6: 124,326,572	W1066R	probably benign	Het
Cd226	A	T	18: 89,207,183	H68L	probably benign	Het
Cdkn3	T	A	14: 46,767,217	C79S	probably null	Het
Cnnm1	A	T	19: 43,469,723	E658V	probably benign	Het
Cog7	T	C	7: 121,956,029	R304G	probably damaging	Het
Cpt1a	T	A	19: 3,365,760	V286E	possibly damaging	Het
Creg2	C	A	1: 39,624,954	R212L	probably benign	Het
Cyp26a1	T	G	19: 37,699,962	S311A	probably damaging	Het
Cyp2b10	T	C	7: 25,926,223	Y484H	probably benign	Het
Cyp3a44	T	A	5: 145,788,467	Y308F	possibly damaging	Het
Dlg5	A	G	14: 24,164,089	V744A	probably benign	Het
Dlgap2	T	A	8: 14,727,128	Y124*	probably null	Het
Dnah3	T	C	7: 119,922,880	D4030G	probably benign	Het
Dnah5	A	G	15: 28,458,584	T4456A	possibly damaging	Het
Dtx2	T	A	5: 136,023,699	V347D	probably benign	Het
Gigyf2	C	T	1: 87,407,167	T294M	probably damaging	Het
Gli3	C	G	13: 15,726,162	S1378*	probably null	Het
Gm884	A	G	11: 103,542,120	S1232P	possibly damaging	Het
Gnao1	G	A	8: 93,966,999	D337N	probably benign	Het
Gp2	T	A	7: 119,449,129	Q422L	probably benign	Het
Ifit1	T	A	19: 34,648,469	M335K	possibly damaging	Het
Ism1	T	C	2: 139,678,757	S30P	probably benign	Het
Itgax	A	G	7: 128,140,447	D677G	probably damaging	Het
Kansl1l	G	A	1: 66,725,922	A442V	probably damaging	Het
Kif13a	T	C	13: 46,771,524	I311M	probably damaging	Het
Lsm14b	T	A	2: 180,031,425	S84R	probably benign	Het
Lzts3	A	G	2: 130,636,288	Y297H	probably damaging	Het
Map4k3	A	G	17: 80,644,762	I205T	probably damaging	Het
Matn2	A	T	15: 34,410,165	N501I	probably damaging	Het
Mctp2	T	C	7: 72,103,177	E776G	probably damaging	Het
Mex3d	A	T	10: 80,382,587	N265K	probably damaging	Het
Myo5a	A	G	9: 75,203,833	T1534A	probably benign	Het
Ncoa7	T	C	10: 30,704,636	M35V	probably damaging	Het
Nek4	G	A	14: 30,957,079		probably null	Het
Ngrn	T	C	7: 80,261,933		probably null	Het
Nlrp1a	T	A	11: 71,123,020	Q468L	probably benign	Het
Olfr1450	A	C	19: 12,954,531	Q314P	probably benign	Het
Olfr743	T	A	14: 50,534,198	M262K	probably damaging	Het
Phtf2	T	C	5: 20,775,934	D433G	probably damaging	Het
Prdm13	G	A	4: 21,683,852	Q140*	probably null	Het
Prtg	G	A	9: 72,892,254	G778E	probably benign	Het
Pum3	T	C	19: 27,420,051	E308G	probably damaging	Het
Pwp1	T	G	10: 85,882,886	F306V	probably damaging	Het
Rab24	A	T	13: 55,321,576	Y27N	probably damaging	Het
Rnf215	T	C	11: 4,135,898	F126L	probably benign	Het
Samd13	A	T	3: 146,680,696		probably benign	Het
Serac1	T	A	17: 6,065,049	H213L	probably benign	Het
Slc45a3	A	G	1: 131,978,073	E278G	probably damaging	Het
Slit3	C	T	11: 35,700,236	R1292C	probably damaging	Het
Slx4	A	T	16: 4,000,951		probably null	Het
Smarca4	C	A	9: 21,647,430	T631K	probably benign	Het
Snx16	C	T	3: 10,434,481	R163Q	possibly damaging	Het
Stk40	T	C	4: 126,128,895	V140A	probably damaging	Het
Tcf12	A	T	9: 71,868,240	D409E	probably damaging	Het
Tgfbr2	G	T	9: 116,110,255	T168K	possibly damaging	Het
Ticam1	G	T	17: 56,271,703	H131N	probably damaging	Het
Ttn	C	A	2: 76,713,511	E31298*	probably null	Het
Ttn	C	A	2: 76,829,888	R7458I	possibly damaging	Het
Usp7	A	G	16: 8,712,102	V133A	possibly damaging	Het
Wbp1l	C	T	19: 46,654,180	R191*	probably null	Het
Wdfy4	T	C	14: 33,106,011	E1118G	probably damaging	Het
Zfp81	G	C	17: 33,336,845	P3A	probably damaging	Het
Znhit6	A	G	3: 145,576,933	K21R	possibly damaging	Het

Other mutations in Agl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00235:Agl	APN	3	116771483	missense	probably benign	0.10
IGL00500:Agl	APN	3	116772820	missense	probably damaging	1.00
IGL00691:Agl	APN	3	116779258	missense	possibly damaging	0.46
IGL00711:Agl	APN	3	116793627	missense	probably damaging	1.00
IGL01291:Agl	APN	3	116772789	missense	possibly damaging	0.49
IGL01641:Agl	APN	3	116784455	nonsense	probably null
IGL01860:Agl	APN	3	116772526	splice site	probably benign
IGL01893:Agl	APN	3	116788549	missense	probably damaging	0.97
IGL02193:Agl	APN	3	116779166	missense	probably damaging	0.99
IGL02379:Agl	APN	3	116779091	missense	probably damaging	1.00
IGL02485:Agl	APN	3	116779080	missense	probably benign
IGL02644:Agl	APN	3	116786597	missense	probably damaging	1.00
IGL02673:Agl	APN	3	116781599	missense	probably benign	0.01
IGL02693:Agl	APN	3	116746428	missense	possibly damaging	0.67
IGL02733:Agl	APN	3	116780997	missense	probably benign
IGL03089:Agl	APN	3	116781023	missense	probably damaging	1.00
IGL03271:Agl	APN	3	116779127	missense	probably benign	0.00
ANU05:Agl	UTSW	3	116772789	missense	possibly damaging	0.49
PIT4445001:Agl	UTSW	3	116771460	missense
R0013:Agl	UTSW	3	116776608	nonsense	probably null
R0013:Agl	UTSW	3	116776608	nonsense	probably null
R0022:Agl	UTSW	3	116793836	splice site	probably null
R0092:Agl	UTSW	3	116793804	missense	probably damaging	1.00
R0226:Agl	UTSW	3	116752071	missense	probably damaging	1.00
R0440:Agl	UTSW	3	116758806	missense	probably damaging	1.00
R0488:Agl	UTSW	3	116754962	nonsense	probably null
R0504:Agl	UTSW	3	116786784	missense	probably damaging	0.99
R0689:Agl	UTSW	3	116793628	missense	probably damaging	1.00
R0715:Agl	UTSW	3	116752176	missense	probably damaging	1.00
R0893:Agl	UTSW	3	116753286	missense	probably benign	0.04
R1403:Agl	UTSW	3	116782597	missense	probably benign	0.12
R1403:Agl	UTSW	3	116782597	missense	probably benign	0.12
R1432:Agl	UTSW	3	116746693	missense	probably damaging	1.00
R1465:Agl	UTSW	3	116771372	missense	probably benign	0.35
R1465:Agl	UTSW	3	116771372	missense	probably benign	0.35
R1540:Agl	UTSW	3	116780735	missense	probably benign	0.01
R1624:Agl	UTSW	3	116787246	missense	probably benign	0.30
R1640:Agl	UTSW	3	116752090	missense	probably benign	0.02
R1834:Agl	UTSW	3	116788351	missense	probably benign	0.31
R1853:Agl	UTSW	3	116779322	nonsense	probably null
R2004:Agl	UTSW	3	116781265	missense	probably damaging	1.00
R2184:Agl	UTSW	3	116780777	missense	probably benign	0.00
R2227:Agl	UTSW	3	116788312	missense	possibly damaging	0.78
R3053:Agl	UTSW	3	116791033	missense	probably damaging	1.00
R4181:Agl	UTSW	3	116746630	missense	probably damaging	1.00
R4241:Agl	UTSW	3	116754848	intron	probably benign
R4284:Agl	UTSW	3	116752178	missense	possibly damaging	0.83
R4285:Agl	UTSW	3	116752178	missense	possibly damaging	0.83
R4302:Agl	UTSW	3	116746630	missense	probably damaging	1.00
R4791:Agl	UTSW	3	116786528	critical splice donor site	probably null
R4854:Agl	UTSW	3	116778618	critical splice donor site	probably null
R4968:Agl	UTSW	3	116788526	missense	probably benign	0.31
R5075:Agl	UTSW	3	116793807	missense	probably damaging	1.00
R5219:Agl	UTSW	3	116778721	missense	possibly damaging	0.81
R5274:Agl	UTSW	3	116772486	missense	probably damaging	1.00
R5347:Agl	UTSW	3	116791165	missense	probably damaging	1.00
R5399:Agl	UTSW	3	116781628	missense	probably damaging	1.00
R5511:Agl	UTSW	3	116788560	missense	possibly damaging	0.81
R5763:Agl	UTSW	3	116753360	missense	probably damaging	1.00
R5827:Agl	UTSW	3	116781054	missense	probably damaging	1.00
R5967:Agl	UTSW	3	116793708	missense	probably benign	0.06
R5986:Agl	UTSW	3	116772496	missense	probably damaging	1.00
R6127:Agl	UTSW	3	116758329	missense	probably damaging	1.00
R6209:Agl	UTSW	3	116785196	nonsense	probably null
R6252:Agl	UTSW	3	116787229	critical splice donor site	probably null
R6337:Agl	UTSW	3	116786777	missense	possibly damaging	0.65
R6366:Agl	UTSW	3	116791117	missense	probably damaging	1.00
R6441:Agl	UTSW	3	116771459	missense	probably benign	0.21
R6647:Agl	UTSW	3	116750411	missense	probably damaging	1.00
R6678:Agl	UTSW	3	116753320	missense	probably damaging	0.99
R6736:Agl	UTSW	3	116781680	missense	probably damaging	0.98
R7141:Agl	UTSW	3	116753286	missense	probably benign	0.04
R7143:Agl	UTSW	3	116792021	missense	probably damaging	0.99
R7204:Agl	UTSW	3	116793820	missense	probably benign	0.04
R7259:Agl	UTSW	3	116784581	missense	probably damaging	1.00
R7393:Agl	UTSW	3	116791156	missense	probably benign
R7426:Agl	UTSW	3	116758755	missense
R7559:Agl	UTSW	3	116752115	missense
R7587:Agl	UTSW	3	116792087	missense	probably damaging	1.00
R7609:Agl	UTSW	3	116807279	missense	possibly damaging	0.93
R7657:Agl	UTSW	3	116779163	missense
R7715:Agl	UTSW	3	116758256	missense
R7735:Agl	UTSW	3	116785146	missense	probably benign	0.21
R7770:Agl	UTSW	3	116758237	critical splice donor site	probably null
R7980:Agl	UTSW	3	116792181	missense	probably benign	0.08
R8186:Agl	UTSW	3	116758908	missense	possibly damaging	0.92
R8215:Agl	UTSW	3	116788644	missense	probably damaging	1.00
R8336:Agl	UTSW	3	116772846	missense
X0065:Agl	UTSW	3	116781330	nonsense	probably null
Z1177:Agl	UTSW	3	116781036	missense

Predicted Primers

PCR Primer
(F):5'- TATGTTAACTGCAGCCTACCC -3'
(R):5'- CTAAATCGAAGTGCCAAGTAGTTCC -3'

Sequencing Primer
(F):5'- CCTACCCTTGAAGGAAGTAGTACTG -3'
(R):5'- TCGAAGTGCCAAGTAGTTCCAAAAG -3'

Posted On

2017-03-31