Incidental Mutation 'R5964:Phtf2'
ID 471936
Institutional Source Beutler Lab
Gene Symbol Phtf2
Ensembl Gene ENSMUSG00000039987
Gene Name putative homeodomain transcription factor 2
Synonyms
MMRRC Submission 044149-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5964 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 20758663-20882124 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 20775934 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 433 (D433G)
Ref Sequence ENSEMBL: ENSMUSP00000114087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118174] [ENSMUST00000153194]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000118174
AA Change: D433G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114087
Gene: ENSMUSG00000039987
AA Change: D433G

DomainStartEndE-ValueType
Pfam:Phtf-FEM1B_bdg 5 154 1.3e-76 PFAM
low complexity region 340 359 N/A INTRINSIC
transmembrane domain 457 479 N/A INTRINSIC
transmembrane domain 511 533 N/A INTRINSIC
transmembrane domain 596 618 N/A INTRINSIC
transmembrane domain 628 647 N/A INTRINSIC
transmembrane domain 715 737 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153194
SMART Domains Protein: ENSMUSP00000120624
Gene: ENSMUSG00000039987

DomainStartEndE-ValueType
transmembrane domain 6 28 N/A INTRINSIC
transmembrane domain 91 113 N/A INTRINSIC
transmembrane domain 123 142 N/A INTRINSIC
Meta Mutation Damage Score 0.1965 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.2%
Validation Efficiency 96% (87/91)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam15 G A 3: 89,343,567 Q581* probably null Het
Agl A G 3: 116,793,774 V44A probably damaging Het
Alpk3 T A 7: 81,092,260 D608E possibly damaging Het
Aspm C A 1: 139,455,227 probably benign Het
Bbs2 T C 8: 94,068,367 N692S probably benign Het
Bend4 A G 5: 67,417,818 I240T probably benign Het
Casp8 G T 1: 58,833,736 R277L possibly damaging Het
Ccdc61 A T 7: 18,900,940 I123N probably damaging Het
Ccr9 T G 9: 123,779,434 I60M probably benign Het
Cd163 T A 6: 124,326,572 W1066R probably benign Het
Cd226 A T 18: 89,207,183 H68L probably benign Het
Cdkn3 T A 14: 46,767,217 C79S probably null Het
Cnnm1 A T 19: 43,469,723 E658V probably benign Het
Cog7 T C 7: 121,956,029 R304G probably damaging Het
Cpt1a T A 19: 3,365,760 V286E possibly damaging Het
Creg2 C A 1: 39,624,954 R212L probably benign Het
Cyp26a1 T G 19: 37,699,962 S311A probably damaging Het
Cyp2b10 T C 7: 25,926,223 Y484H probably benign Het
Cyp3a44 T A 5: 145,788,467 Y308F possibly damaging Het
Dlg5 A G 14: 24,164,089 V744A probably benign Het
Dlgap2 T A 8: 14,727,128 Y124* probably null Het
Dnah3 T C 7: 119,922,880 D4030G probably benign Het
Dnah5 A G 15: 28,458,584 T4456A possibly damaging Het
Dtx2 T A 5: 136,023,699 V347D probably benign Het
Gigyf2 C T 1: 87,407,167 T294M probably damaging Het
Gli3 C G 13: 15,726,162 S1378* probably null Het
Gm884 A G 11: 103,542,120 S1232P possibly damaging Het
Gnao1 G A 8: 93,966,999 D337N probably benign Het
Gp2 T A 7: 119,449,129 Q422L probably benign Het
Ifit1 T A 19: 34,648,469 M335K possibly damaging Het
Ism1 T C 2: 139,678,757 S30P probably benign Het
Itgax A G 7: 128,140,447 D677G probably damaging Het
Kansl1l G A 1: 66,725,922 A442V probably damaging Het
Kif13a T C 13: 46,771,524 I311M probably damaging Het
Lsm14b T A 2: 180,031,425 S84R probably benign Het
Lzts3 A G 2: 130,636,288 Y297H probably damaging Het
Map4k3 A G 17: 80,644,762 I205T probably damaging Het
Matn2 A T 15: 34,410,165 N501I probably damaging Het
Mctp2 T C 7: 72,103,177 E776G probably damaging Het
Mex3d A T 10: 80,382,587 N265K probably damaging Het
Myo5a A G 9: 75,203,833 T1534A probably benign Het
Ncoa7 T C 10: 30,704,636 M35V probably damaging Het
Nek4 G A 14: 30,957,079 probably null Het
Ngrn T C 7: 80,261,933 probably null Het
Nlrp1a T A 11: 71,123,020 Q468L probably benign Het
Olfr1450 A C 19: 12,954,531 Q314P probably benign Het
Olfr743 T A 14: 50,534,198 M262K probably damaging Het
Prdm13 G A 4: 21,683,852 Q140* probably null Het
Prtg G A 9: 72,892,254 G778E probably benign Het
Pum3 T C 19: 27,420,051 E308G probably damaging Het
Pwp1 T G 10: 85,882,886 F306V probably damaging Het
Rab24 A T 13: 55,321,576 Y27N probably damaging Het
Rnf215 T C 11: 4,135,898 F126L probably benign Het
Samd13 A T 3: 146,680,696 probably benign Het
Serac1 T A 17: 6,065,049 H213L probably benign Het
Slc45a3 A G 1: 131,978,073 E278G probably damaging Het
Slit3 C T 11: 35,700,236 R1292C probably damaging Het
Slx4 A T 16: 4,000,951 probably null Het
Smarca4 C A 9: 21,647,430 T631K probably benign Het
Snx16 C T 3: 10,434,481 R163Q possibly damaging Het
Stk40 T C 4: 126,128,895 V140A probably damaging Het
Tcf12 A T 9: 71,868,240 D409E probably damaging Het
Tgfbr2 G T 9: 116,110,255 T168K possibly damaging Het
Ticam1 G T 17: 56,271,703 H131N probably damaging Het
Ttn C A 2: 76,829,888 R7458I possibly damaging Het
Ttn C A 2: 76,713,511 E31298* probably null Het
Usp7 A G 16: 8,712,102 V133A possibly damaging Het
Wbp1l C T 19: 46,654,180 R191* probably null Het
Wdfy4 T C 14: 33,106,011 E1118G probably damaging Het
Zfp81 G C 17: 33,336,845 P3A probably damaging Het
Znhit6 A G 3: 145,576,933 K21R possibly damaging Het
Other mutations in Phtf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01443:Phtf2 APN 5 20782267 unclassified probably benign
IGL01789:Phtf2 APN 5 20794374 missense probably benign 0.00
IGL01816:Phtf2 APN 5 20803276 missense probably damaging 1.00
IGL02266:Phtf2 APN 5 20805799 missense probably damaging 1.00
IGL02295:Phtf2 APN 5 20807430 missense probably damaging 1.00
IGL03086:Phtf2 APN 5 20764275 missense probably damaging 0.99
IGL03179:Phtf2 APN 5 20782399 missense probably damaging 1.00
IGL03192:Phtf2 APN 5 20761719 missense probably damaging 0.99
IGL03256:Phtf2 APN 5 20803252 missense probably damaging 0.98
PIT4480001:Phtf2 UTSW 5 20813244 missense probably damaging 1.00
PIT4802001:Phtf2 UTSW 5 20801906 missense probably damaging 0.96
R0589:Phtf2 UTSW 5 20813251 nonsense probably null
R1732:Phtf2 UTSW 5 20789627 critical splice donor site probably null
R3151:Phtf2 UTSW 5 20765804 missense probably damaging 1.00
R3791:Phtf2 UTSW 5 20782298 missense probably damaging 1.00
R3843:Phtf2 UTSW 5 20774022 missense probably damaging 1.00
R4080:Phtf2 UTSW 5 20813296 missense probably damaging 1.00
R4569:Phtf2 UTSW 5 20789595 intron probably benign
R4627:Phtf2 UTSW 5 20773740 missense probably damaging 1.00
R4901:Phtf2 UTSW 5 20805724 missense possibly damaging 0.73
R5131:Phtf2 UTSW 5 20774052 missense probably damaging 1.00
R5276:Phtf2 UTSW 5 20772197 missense probably benign 0.19
R5871:Phtf2 UTSW 5 20794401 missense probably benign 0.16
R5941:Phtf2 UTSW 5 20774073 missense probably damaging 0.98
R6318:Phtf2 UTSW 5 20801941 missense probably damaging 1.00
R6621:Phtf2 UTSW 5 20812956 intron probably benign
R6684:Phtf2 UTSW 5 20812939 critical splice donor site probably benign
R7003:Phtf2 UTSW 5 20794401 missense probably benign 0.16
R7253:Phtf2 UTSW 5 20765858 missense possibly damaging 0.73
R7566:Phtf2 UTSW 5 20765801 missense probably damaging 1.00
R7654:Phtf2 UTSW 5 20782461 missense probably damaging 0.99
R8117:Phtf2 UTSW 5 20802040 missense probably benign 0.30
R8514:Phtf2 UTSW 5 20802032 missense possibly damaging 0.49
R8921:Phtf2 UTSW 5 20803277 missense probably benign 0.00
R8975:Phtf2 UTSW 5 20764251 missense probably damaging 1.00
R9028:Phtf2 UTSW 5 20794375 missense probably benign
R9164:Phtf2 UTSW 5 20803192 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGAAGGGTCTGTTGGCAAATC -3'
(R):5'- CCTATTCCAGCTCCACTGTAAG -3'

Sequencing Primer
(F):5'- GGCAAATCACTTTTTAGATGGGG -3'
(R):5'- CCAGCTCCACTGTAAGTTCTAC -3'
Posted On 2017-03-31