Mutagenetix > Incidental Mutation

Incidental Mutation 'R5964:Cd163'

471941

Institutional Source

Beutler Lab

Gene Symbol

Cd163

Ensembl Gene

ENSMUSG00000008845

Gene Name

CD163 antigen

Synonyms

MMRRC Submission

044149-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5964 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

124304656-124330527 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 124326572 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 1066 (W1066R)

Ref Sequence

ENSEMBL: ENSMUSP00000108160 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032234] [ENSMUST00000112541]

AlphaFold

Q2VLH6

Predicted Effect

probably benign
Transcript: ENSMUST00000032234
AA Change: W1066R

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000032234
Gene: ENSMUSG00000008845
AA Change: W1066R

Domain	Start	End	E-Value	Type
transmembrane domain	20	42	N/A	INTRINSIC
SR	50	150	1.1e-52	SMART
SR	157	258	1.4e-55	SMART
SR	265	365	7.3e-60	SMART
SR	372	472	1.2e-35	SMART
SR	477	577	2.3e-41	SMART
SR	582	682	9.8e-39	SMART
SR	719	819	1.1e-60	SMART
SR	824	927	4e-24	SMART
SR	930	1030	2.3e-55	SMART
transmembrane domain	1046	1068	N/A	INTRINSIC
low complexity region	1095	1107	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112541
AA Change: W1066R

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000108160
Gene: ENSMUSG00000008845
AA Change: W1066R

Domain	Start	End	E-Value	Type
signal peptide	1	36	N/A	INTRINSIC
SR	50	150	2.26e-50	SMART
SR	157	258	3.11e-53	SMART
SR	265	365	1.54e-57	SMART
SR	372	472	2.64e-33	SMART
SR	477	577	5.03e-39	SMART
SR	582	682	2.09e-36	SMART
SR	719	819	2.38e-58	SMART
SR	824	927	8.93e-22	SMART
SR	930	1030	5.06e-53	SMART
transmembrane domain	1046	1068	N/A	INTRINSIC
low complexity region	1095	1107	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203210

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.2%

Validation Efficiency

96% (87/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the scavenger receptor cysteine-rich (SRCR) superfamily, and is exclusively expressed in monocytes and macrophages. It functions as an acute phase-regulated receptor involved in the clearance and endocytosis of hemoglobin/haptoglobin complexes by macrophages, and may thereby protect tissues from free hemoglobin-mediated oxidative damage. This protein may also function as an innate immune sensor for bacteria and inducer of local inflammation. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: After hindlimb ischemia, mice homozygous for a knock-out allele exhibit increased muscle satellite cell proliferation, and enhanced skeletal muscle regeneration not limited to the site of injury. Knock-out mice also exhibit increased eosinophilic airway inflammation in house dust mite-challenged. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam15	G	A	3: 89,343,567	Q581*	probably null	Het
Agl	A	G	3: 116,793,774	V44A	probably damaging	Het
Alpk3	T	A	7: 81,092,260	D608E	possibly damaging	Het
Aspm	C	A	1: 139,455,227		probably benign	Het
Bbs2	T	C	8: 94,068,367	N692S	probably benign	Het
Bend4	A	G	5: 67,417,818	I240T	probably benign	Het
Casp8	G	T	1: 58,833,736	R277L	possibly damaging	Het
Ccdc61	A	T	7: 18,900,940	I123N	probably damaging	Het
Ccr9	T	G	9: 123,779,434	I60M	probably benign	Het
Cd226	A	T	18: 89,207,183	H68L	probably benign	Het
Cdkn3	T	A	14: 46,767,217	C79S	probably null	Het
Cnnm1	A	T	19: 43,469,723	E658V	probably benign	Het
Cog7	T	C	7: 121,956,029	R304G	probably damaging	Het
Cpt1a	T	A	19: 3,365,760	V286E	possibly damaging	Het
Creg2	C	A	1: 39,624,954	R212L	probably benign	Het
Cyp26a1	T	G	19: 37,699,962	S311A	probably damaging	Het
Cyp2b10	T	C	7: 25,926,223	Y484H	probably benign	Het
Cyp3a44	T	A	5: 145,788,467	Y308F	possibly damaging	Het
Dlg5	A	G	14: 24,164,089	V744A	probably benign	Het
Dlgap2	T	A	8: 14,727,128	Y124*	probably null	Het
Dnah3	T	C	7: 119,922,880	D4030G	probably benign	Het
Dnah5	A	G	15: 28,458,584	T4456A	possibly damaging	Het
Dtx2	T	A	5: 136,023,699	V347D	probably benign	Het
Gigyf2	C	T	1: 87,407,167	T294M	probably damaging	Het
Gli3	C	G	13: 15,726,162	S1378*	probably null	Het
Gm884	A	G	11: 103,542,120	S1232P	possibly damaging	Het
Gnao1	G	A	8: 93,966,999	D337N	probably benign	Het
Gp2	T	A	7: 119,449,129	Q422L	probably benign	Het
Ifit1	T	A	19: 34,648,469	M335K	possibly damaging	Het
Ism1	T	C	2: 139,678,757	S30P	probably benign	Het
Itgax	A	G	7: 128,140,447	D677G	probably damaging	Het
Kansl1l	G	A	1: 66,725,922	A442V	probably damaging	Het
Kif13a	T	C	13: 46,771,524	I311M	probably damaging	Het
Lsm14b	T	A	2: 180,031,425	S84R	probably benign	Het
Lzts3	A	G	2: 130,636,288	Y297H	probably damaging	Het
Map4k3	A	G	17: 80,644,762	I205T	probably damaging	Het
Matn2	A	T	15: 34,410,165	N501I	probably damaging	Het
Mctp2	T	C	7: 72,103,177	E776G	probably damaging	Het
Mex3d	A	T	10: 80,382,587	N265K	probably damaging	Het
Myo5a	A	G	9: 75,203,833	T1534A	probably benign	Het
Ncoa7	T	C	10: 30,704,636	M35V	probably damaging	Het
Nek4	G	A	14: 30,957,079		probably null	Het
Ngrn	T	C	7: 80,261,933		probably null	Het
Nlrp1a	T	A	11: 71,123,020	Q468L	probably benign	Het
Olfr1450	A	C	19: 12,954,531	Q314P	probably benign	Het
Olfr743	T	A	14: 50,534,198	M262K	probably damaging	Het
Phtf2	T	C	5: 20,775,934	D433G	probably damaging	Het
Prdm13	G	A	4: 21,683,852	Q140*	probably null	Het
Prtg	G	A	9: 72,892,254	G778E	probably benign	Het
Pum3	T	C	19: 27,420,051	E308G	probably damaging	Het
Pwp1	T	G	10: 85,882,886	F306V	probably damaging	Het
Rab24	A	T	13: 55,321,576	Y27N	probably damaging	Het
Rnf215	T	C	11: 4,135,898	F126L	probably benign	Het
Samd13	A	T	3: 146,680,696		probably benign	Het
Serac1	T	A	17: 6,065,049	H213L	probably benign	Het
Slc45a3	A	G	1: 131,978,073	E278G	probably damaging	Het
Slit3	C	T	11: 35,700,236	R1292C	probably damaging	Het
Slx4	A	T	16: 4,000,951		probably null	Het
Smarca4	C	A	9: 21,647,430	T631K	probably benign	Het
Snx16	C	T	3: 10,434,481	R163Q	possibly damaging	Het
Stk40	T	C	4: 126,128,895	V140A	probably damaging	Het
Tcf12	A	T	9: 71,868,240	D409E	probably damaging	Het
Tgfbr2	G	T	9: 116,110,255	T168K	possibly damaging	Het
Ticam1	G	T	17: 56,271,703	H131N	probably damaging	Het
Ttn	C	A	2: 76,713,511	E31298*	probably null	Het
Ttn	C	A	2: 76,829,888	R7458I	possibly damaging	Het
Usp7	A	G	16: 8,712,102	V133A	possibly damaging	Het
Wbp1l	C	T	19: 46,654,180	R191*	probably null	Het
Wdfy4	T	C	14: 33,106,011	E1118G	probably damaging	Het
Zfp81	G	C	17: 33,336,845	P3A	probably damaging	Het
Znhit6	A	G	3: 145,576,933	K21R	possibly damaging	Het

Other mutations in Cd163

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Cd163	APN	6	124329101	splice site	probably benign
IGL00755:Cd163	APN	6	124318657	missense	possibly damaging	0.70
IGL01690:Cd163	APN	6	124307318	missense	possibly damaging	0.89
IGL02101:Cd163	APN	6	124307287	nonsense	probably null
IGL02733:Cd163	APN	6	124325341	missense	probably damaging	1.00
IGL02801:Cd163	APN	6	124320529	missense	probably benign	0.00
IGL02897:Cd163	APN	6	124325527	missense	probably damaging	1.00
IGL03074:Cd163	APN	6	124317986	missense	probably benign	0.00
IGL03283:Cd163	APN	6	124309199	missense	possibly damaging	0.49
compass	UTSW	6	124329086	makesense	probably null
hottish	UTSW	6	124309208	missense	probably damaging	1.00
protractor	UTSW	6	124311566	missense	probably damaging	1.00
t-square	UTSW	6	124325288	missense	probably damaging	0.97
R0494:Cd163	UTSW	6	124311449	missense	probably damaging	1.00
R0554:Cd163	UTSW	6	124312660	missense	probably benign	0.03
R0622:Cd163	UTSW	6	124317352	missense	probably damaging	1.00
R1004:Cd163	UTSW	6	124325347	missense	probably damaging	1.00
R1061:Cd163	UTSW	6	124309169	missense	probably benign	0.00
R1132:Cd163	UTSW	6	124309096	nonsense	probably null
R1195:Cd163	UTSW	6	124325250	splice site	probably benign
R1195:Cd163	UTSW	6	124325250	splice site	probably benign
R1436:Cd163	UTSW	6	124327931	missense	possibly damaging	0.47
R1463:Cd163	UTSW	6	124311447	missense	probably damaging	1.00
R1532:Cd163	UTSW	6	124312730	missense	possibly damaging	0.91
R1541:Cd163	UTSW	6	124327961	missense	probably benign
R1654:Cd163	UTSW	6	124317581	missense	probably damaging	1.00
R1717:Cd163	UTSW	6	124329588	utr 3 prime	probably benign
R1744:Cd163	UTSW	6	124307028	missense	possibly damaging	0.94
R2014:Cd163	UTSW	6	124325498	missense	probably damaging	0.99
R2035:Cd163	UTSW	6	124320629	missense	probably damaging	0.97
R2095:Cd163	UTSW	6	124317822	missense	probably damaging	1.00
R2124:Cd163	UTSW	6	124318856	missense	probably damaging	1.00
R2146:Cd163	UTSW	6	124309208	missense	probably damaging	1.00
R2353:Cd163	UTSW	6	124319156	nonsense	probably null
R3854:Cd163	UTSW	6	124311566	missense	probably damaging	1.00
R4425:Cd163	UTSW	6	124327903	missense	possibly damaging	0.94
R4631:Cd163	UTSW	6	124329086	makesense	probably null
R4647:Cd163	UTSW	6	124320621	missense	probably damaging	1.00
R4713:Cd163	UTSW	6	124317618	critical splice donor site	probably null
R4803:Cd163	UTSW	6	124312430	missense	probably damaging	0.99
R4996:Cd163	UTSW	6	124319147	missense	probably benign	0.00
R5022:Cd163	UTSW	6	124325288	missense	probably damaging	0.97
R5023:Cd163	UTSW	6	124325288	missense	probably damaging	0.97
R5032:Cd163	UTSW	6	124311669	missense	probably damaging	1.00
R5057:Cd163	UTSW	6	124325288	missense	probably damaging	0.97
R5121:Cd163	UTSW	6	124317989	missense	probably damaging	1.00
R5436:Cd163	UTSW	6	124327964	missense	probably benign
R5453:Cd163	UTSW	6	124312541	missense	probably damaging	1.00
R5723:Cd163	UTSW	6	124319063	missense	probably benign	0.00
R5929:Cd163	UTSW	6	124326609	critical splice donor site	probably null
R5943:Cd163	UTSW	6	124329602	makesense	probably null
R5966:Cd163	UTSW	6	124320636	nonsense	probably null
R6279:Cd163	UTSW	6	124317991	nonsense	probably null
R6300:Cd163	UTSW	6	124317991	nonsense	probably null
R6499:Cd163	UTSW	6	124304744	missense	probably benign	0.00
R6602:Cd163	UTSW	6	124311635	missense	probably damaging	1.00
R6708:Cd163	UTSW	6	124309208	missense	probably damaging	1.00
R6767:Cd163	UTSW	6	124304779	missense	possibly damaging	0.56
R6979:Cd163	UTSW	6	124317986	missense	probably benign	0.00
R6993:Cd163	UTSW	6	124317714	missense	probably damaging	1.00
R7345:Cd163	UTSW	6	124318938	missense	possibly damaging	0.52
R7382:Cd163	UTSW	6	124311312	splice site	probably null
R7552:Cd163	UTSW	6	124307228	missense	probably benign	0.08
R7829:Cd163	UTSW	6	124304779	missense	probably benign	0.04
R8354:Cd163	UTSW	6	124328965	missense	probably benign	0.43
R8454:Cd163	UTSW	6	124328965	missense	probably benign	0.43
R8530:Cd163	UTSW	6	124318901	missense	probably damaging	1.00
R8560:Cd163	UTSW	6	124317401	missense	possibly damaging	0.86
R8878:Cd163	UTSW	6	124320510	missense	probably damaging	0.99
R8930:Cd163	UTSW	6	124317923	missense	probably damaging	1.00
R8932:Cd163	UTSW	6	124317923	missense	probably damaging	1.00
R9074:Cd163	UTSW	6	124308988	nonsense	probably null
R9408:Cd163	UTSW	6	124320538	missense	probably benign	0.39
R9530:Cd163	UTSW	6	124317532	nonsense	probably null
R9558:Cd163	UTSW	6	124320512	missense	probably benign	0.01
R9608:Cd163	UTSW	6	124309204	missense	possibly damaging	0.79
R9685:Cd163	UTSW	6	124311425	missense	possibly damaging	0.77
Z1177:Cd163	UTSW	6	124317385	missense	probably benign	0.34

Predicted Primers

PCR Primer
(F):5'- AATCCCTCTTGTTTAGGAGACTTTG -3'
(R):5'- GGCCTCCAAAGGGAATTTTG -3'

Sequencing Primer
(F):5'- ACTTTGAGTCATAAGGAGCCC -3'
(R):5'- ATATTCCAAGAAACTCTTCAAACCTC -3'

Posted On

2017-03-31