Incidental Mutation 'R5964:Cd163'
ID471941
Institutional Source Beutler Lab
Gene Symbol Cd163
Ensembl Gene ENSMUSG00000008845
Gene NameCD163 antigen
Synonyms
MMRRC Submission 044149-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5964 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location124304656-124330527 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 124326572 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 1066 (W1066R)
Ref Sequence ENSEMBL: ENSMUSP00000108160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032234] [ENSMUST00000112541]
Predicted Effect probably benign
Transcript: ENSMUST00000032234
AA Change: W1066R

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000032234
Gene: ENSMUSG00000008845
AA Change: W1066R

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
SR 50 150 1.1e-52 SMART
SR 157 258 1.4e-55 SMART
SR 265 365 7.3e-60 SMART
SR 372 472 1.2e-35 SMART
SR 477 577 2.3e-41 SMART
SR 582 682 9.8e-39 SMART
SR 719 819 1.1e-60 SMART
SR 824 927 4e-24 SMART
SR 930 1030 2.3e-55 SMART
transmembrane domain 1046 1068 N/A INTRINSIC
low complexity region 1095 1107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112541
AA Change: W1066R

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000108160
Gene: ENSMUSG00000008845
AA Change: W1066R

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
SR 50 150 2.26e-50 SMART
SR 157 258 3.11e-53 SMART
SR 265 365 1.54e-57 SMART
SR 372 472 2.64e-33 SMART
SR 477 577 5.03e-39 SMART
SR 582 682 2.09e-36 SMART
SR 719 819 2.38e-58 SMART
SR 824 927 8.93e-22 SMART
SR 930 1030 5.06e-53 SMART
transmembrane domain 1046 1068 N/A INTRINSIC
low complexity region 1095 1107 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203210
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.2%
Validation Efficiency 96% (87/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the scavenger receptor cysteine-rich (SRCR) superfamily, and is exclusively expressed in monocytes and macrophages. It functions as an acute phase-regulated receptor involved in the clearance and endocytosis of hemoglobin/haptoglobin complexes by macrophages, and may thereby protect tissues from free hemoglobin-mediated oxidative damage. This protein may also function as an innate immune sensor for bacteria and inducer of local inflammation. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: After hindlimb ischemia, mice homozygous for a knock-out allele exhibit increased muscle satellite cell proliferation, and enhanced skeletal muscle regeneration not limited to the site of injury. Knock-out mice also exhibit increased eosinophilic airway inflammation in house dust mite-challenged. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam15 G A 3: 89,343,567 Q581* probably null Het
Agl A G 3: 116,793,774 V44A probably damaging Het
Alpk3 T A 7: 81,092,260 D608E possibly damaging Het
Aspm C A 1: 139,455,227 probably benign Het
Bbs2 T C 8: 94,068,367 N692S probably benign Het
Bend4 A G 5: 67,417,818 I240T probably benign Het
Casp8 G T 1: 58,833,736 R277L possibly damaging Het
Ccdc61 A T 7: 18,900,940 I123N probably damaging Het
Ccr9 T G 9: 123,779,434 I60M probably benign Het
Cd226 A T 18: 89,207,183 H68L probably benign Het
Cdkn3 T A 14: 46,767,217 C79S probably null Het
Cnnm1 A T 19: 43,469,723 E658V probably benign Het
Cog7 T C 7: 121,956,029 R304G probably damaging Het
Cpt1a T A 19: 3,365,760 V286E possibly damaging Het
Creg2 C A 1: 39,624,954 R212L probably benign Het
Cyp26a1 T G 19: 37,699,962 S311A probably damaging Het
Cyp2b10 T C 7: 25,926,223 Y484H probably benign Het
Cyp3a44 T A 5: 145,788,467 Y308F possibly damaging Het
Dlg5 A G 14: 24,164,089 V744A probably benign Het
Dlgap2 T A 8: 14,727,128 Y124* probably null Het
Dnah3 T C 7: 119,922,880 D4030G probably benign Het
Dnah5 A G 15: 28,458,584 T4456A possibly damaging Het
Dtx2 T A 5: 136,023,699 V347D probably benign Het
Gigyf2 C T 1: 87,407,167 T294M probably damaging Het
Gli3 C G 13: 15,726,162 S1378* probably null Het
Gm884 A G 11: 103,542,120 S1232P possibly damaging Het
Gnao1 G A 8: 93,966,999 D337N probably benign Het
Gp2 T A 7: 119,449,129 Q422L probably benign Het
Ifit1 T A 19: 34,648,469 M335K possibly damaging Het
Ism1 T C 2: 139,678,757 S30P probably benign Het
Itgax A G 7: 128,140,447 D677G probably damaging Het
Kansl1l G A 1: 66,725,922 A442V probably damaging Het
Kif13a T C 13: 46,771,524 I311M probably damaging Het
Lsm14b T A 2: 180,031,425 S84R probably benign Het
Lzts3 A G 2: 130,636,288 Y297H probably damaging Het
Map4k3 A G 17: 80,644,762 I205T probably damaging Het
Matn2 A T 15: 34,410,165 N501I probably damaging Het
Mctp2 T C 7: 72,103,177 E776G probably damaging Het
Mex3d A T 10: 80,382,587 N265K probably damaging Het
Myo5a A G 9: 75,203,833 T1534A probably benign Het
Ncoa7 T C 10: 30,704,636 M35V probably damaging Het
Nek4 G A 14: 30,957,079 probably null Het
Ngrn T C 7: 80,261,933 probably null Het
Nlrp1a T A 11: 71,123,020 Q468L probably benign Het
Olfr1450 A C 19: 12,954,531 Q314P probably benign Het
Olfr743 T A 14: 50,534,198 M262K probably damaging Het
Phtf2 T C 5: 20,775,934 D433G probably damaging Het
Prdm13 G A 4: 21,683,852 Q140* probably null Het
Prtg G A 9: 72,892,254 G778E probably benign Het
Pum3 T C 19: 27,420,051 E308G probably damaging Het
Pwp1 T G 10: 85,882,886 F306V probably damaging Het
Rab24 A T 13: 55,321,576 Y27N probably damaging Het
Rnf215 T C 11: 4,135,898 F126L probably benign Het
Samd13 A T 3: 146,680,696 probably benign Het
Serac1 T A 17: 6,065,049 H213L probably benign Het
Slc45a3 A G 1: 131,978,073 E278G probably damaging Het
Slit3 C T 11: 35,700,236 R1292C probably damaging Het
Slx4 A T 16: 4,000,951 probably null Het
Smarca4 C A 9: 21,647,430 T631K probably benign Het
Snx16 C T 3: 10,434,481 R163Q possibly damaging Het
Stk40 T C 4: 126,128,895 V140A probably damaging Het
Tcf12 A T 9: 71,868,240 D409E probably damaging Het
Tgfbr2 G T 9: 116,110,255 T168K possibly damaging Het
Ticam1 G T 17: 56,271,703 H131N probably damaging Het
Ttn C A 2: 76,713,511 E31298* probably null Het
Ttn C A 2: 76,829,888 R7458I possibly damaging Het
Usp7 A G 16: 8,712,102 V133A possibly damaging Het
Wbp1l C T 19: 46,654,180 R191* probably null Het
Wdfy4 T C 14: 33,106,011 E1118G probably damaging Het
Zfp81 G C 17: 33,336,845 P3A probably damaging Het
Znhit6 A G 3: 145,576,933 K21R possibly damaging Het
Other mutations in Cd163
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Cd163 APN 6 124329101 splice site probably benign
IGL00755:Cd163 APN 6 124318657 missense possibly damaging 0.70
IGL01690:Cd163 APN 6 124307318 missense possibly damaging 0.89
IGL02101:Cd163 APN 6 124307287 nonsense probably null
IGL02733:Cd163 APN 6 124325341 missense probably damaging 1.00
IGL02801:Cd163 APN 6 124320529 missense probably benign 0.00
IGL02897:Cd163 APN 6 124325527 missense probably damaging 1.00
IGL03074:Cd163 APN 6 124317986 missense probably benign 0.00
IGL03283:Cd163 APN 6 124309199 missense possibly damaging 0.49
compass UTSW 6 124329086 makesense probably null
hottish UTSW 6 124309208 missense probably damaging 1.00
protractor UTSW 6 124311566 missense probably damaging 1.00
t-square UTSW 6 124325288 missense probably damaging 0.97
R0494:Cd163 UTSW 6 124311449 missense probably damaging 1.00
R0554:Cd163 UTSW 6 124312660 missense probably benign 0.03
R0622:Cd163 UTSW 6 124317352 missense probably damaging 1.00
R1004:Cd163 UTSW 6 124325347 missense probably damaging 1.00
R1061:Cd163 UTSW 6 124309169 missense probably benign 0.00
R1132:Cd163 UTSW 6 124309096 nonsense probably null
R1195:Cd163 UTSW 6 124325250 splice site probably benign
R1195:Cd163 UTSW 6 124325250 splice site probably benign
R1436:Cd163 UTSW 6 124327931 missense possibly damaging 0.47
R1463:Cd163 UTSW 6 124311447 missense probably damaging 1.00
R1532:Cd163 UTSW 6 124312730 missense possibly damaging 0.91
R1541:Cd163 UTSW 6 124327961 missense probably benign
R1654:Cd163 UTSW 6 124317581 missense probably damaging 1.00
R1717:Cd163 UTSW 6 124329588 utr 3 prime probably benign
R1744:Cd163 UTSW 6 124307028 missense possibly damaging 0.94
R2014:Cd163 UTSW 6 124325498 missense probably damaging 0.99
R2035:Cd163 UTSW 6 124320629 missense probably damaging 0.97
R2095:Cd163 UTSW 6 124317822 missense probably damaging 1.00
R2124:Cd163 UTSW 6 124318856 missense probably damaging 1.00
R2146:Cd163 UTSW 6 124309208 missense probably damaging 1.00
R2353:Cd163 UTSW 6 124319156 nonsense probably null
R3854:Cd163 UTSW 6 124311566 missense probably damaging 1.00
R4425:Cd163 UTSW 6 124327903 missense possibly damaging 0.94
R4631:Cd163 UTSW 6 124329086 makesense probably null
R4647:Cd163 UTSW 6 124320621 missense probably damaging 1.00
R4713:Cd163 UTSW 6 124317618 critical splice donor site probably null
R4803:Cd163 UTSW 6 124312430 missense probably damaging 0.99
R4996:Cd163 UTSW 6 124319147 missense probably benign 0.00
R5022:Cd163 UTSW 6 124325288 missense probably damaging 0.97
R5023:Cd163 UTSW 6 124325288 missense probably damaging 0.97
R5032:Cd163 UTSW 6 124311669 missense probably damaging 1.00
R5057:Cd163 UTSW 6 124325288 missense probably damaging 0.97
R5121:Cd163 UTSW 6 124317989 missense probably damaging 1.00
R5436:Cd163 UTSW 6 124327964 missense probably benign
R5453:Cd163 UTSW 6 124312541 missense probably damaging 1.00
R5723:Cd163 UTSW 6 124319063 missense probably benign 0.00
R5929:Cd163 UTSW 6 124326609 critical splice donor site probably null
R5943:Cd163 UTSW 6 124329602 makesense probably null
R5966:Cd163 UTSW 6 124320636 nonsense probably null
R6279:Cd163 UTSW 6 124317991 nonsense probably null
R6300:Cd163 UTSW 6 124317991 nonsense probably null
R6499:Cd163 UTSW 6 124304744 missense probably benign 0.00
R6602:Cd163 UTSW 6 124311635 missense probably damaging 1.00
R6708:Cd163 UTSW 6 124309208 missense probably damaging 1.00
R6767:Cd163 UTSW 6 124304779 missense possibly damaging 0.56
R6979:Cd163 UTSW 6 124317986 missense probably benign 0.00
R6993:Cd163 UTSW 6 124317714 missense probably damaging 1.00
R7345:Cd163 UTSW 6 124318938 missense possibly damaging 0.52
R7382:Cd163 UTSW 6 124311312 splice site probably null
R7552:Cd163 UTSW 6 124307228 missense probably benign 0.08
R7829:Cd163 UTSW 6 124304779 missense probably benign 0.04
R8354:Cd163 UTSW 6 124328965 missense probably benign 0.43
R8454:Cd163 UTSW 6 124328965 missense probably benign 0.43
Z1177:Cd163 UTSW 6 124317385 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- AATCCCTCTTGTTTAGGAGACTTTG -3'
(R):5'- GGCCTCCAAAGGGAATTTTG -3'

Sequencing Primer
(F):5'- ACTTTGAGTCATAAGGAGCCC -3'
(R):5'- ATATTCCAAGAAACTCTTCAAACCTC -3'
Posted On2017-03-31