Mutagenetix > Incidental Mutation

Incidental Mutation 'R5964:Gp2'

471947

Institutional Source

Beutler Lab

Gene Symbol

Gp2

Ensembl Gene

ENSMUSG00000030954

Gene Name

glycoprotein 2 (zymogen granule membrane)

Synonyms

2310037I18Rik

MMRRC Submission

044149-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5964 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

119442537-119459285 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 119449129 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 422 (Q422L)

Ref Sequence

ENSEMBL: ENSMUSP00000146487 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033255] [ENSMUST00000207887]

AlphaFold

Q9D733

Predicted Effect

probably benign
Transcript: ENSMUST00000033255
AA Change: Q422L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000033255
Gene: ENSMUSG00000030954
AA Change: Q422L

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Blast:ZP	164	213	1e-11	BLAST
ZP	225	477	5.39e-79	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000207887
AA Change: Q422L

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

Meta Mutation Damage Score

0.0682

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.2%

Validation Efficiency

96% (87/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein that is secreted from intracellular zymogen granules and associates with the plasma membrane via glycosylphosphatidylinositol (GPI) linkage. The encoded protein binds pathogens such as enterobacteria, thereby playing an important role in the innate immune response. The C-terminus of this protein is related to the C-terminus of the protein encoded by the neighboring gene, uromodulin (UMOD). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygous null mice display no obvious abnormalities in pancreas morphology and function, development, growth, weight, behavior, life span, or fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam15	G	A	3: 89,343,567	Q581*	probably null	Het
Agl	A	G	3: 116,793,774	V44A	probably damaging	Het
Alpk3	T	A	7: 81,092,260	D608E	possibly damaging	Het
Aspm	C	A	1: 139,455,227		probably benign	Het
Bbs2	T	C	8: 94,068,367	N692S	probably benign	Het
Bend4	A	G	5: 67,417,818	I240T	probably benign	Het
Casp8	G	T	1: 58,833,736	R277L	possibly damaging	Het
Ccdc61	A	T	7: 18,900,940	I123N	probably damaging	Het
Ccr9	T	G	9: 123,779,434	I60M	probably benign	Het
Cd163	T	A	6: 124,326,572	W1066R	probably benign	Het
Cd226	A	T	18: 89,207,183	H68L	probably benign	Het
Cdkn3	T	A	14: 46,767,217	C79S	probably null	Het
Cnnm1	A	T	19: 43,469,723	E658V	probably benign	Het
Cog7	T	C	7: 121,956,029	R304G	probably damaging	Het
Cpt1a	T	A	19: 3,365,760	V286E	possibly damaging	Het
Creg2	C	A	1: 39,624,954	R212L	probably benign	Het
Cyp26a1	T	G	19: 37,699,962	S311A	probably damaging	Het
Cyp2b10	T	C	7: 25,926,223	Y484H	probably benign	Het
Cyp3a44	T	A	5: 145,788,467	Y308F	possibly damaging	Het
Dlg5	A	G	14: 24,164,089	V744A	probably benign	Het
Dlgap2	T	A	8: 14,727,128	Y124*	probably null	Het
Dnah3	T	C	7: 119,922,880	D4030G	probably benign	Het
Dnah5	A	G	15: 28,458,584	T4456A	possibly damaging	Het
Dtx2	T	A	5: 136,023,699	V347D	probably benign	Het
Gigyf2	C	T	1: 87,407,167	T294M	probably damaging	Het
Gli3	C	G	13: 15,726,162	S1378*	probably null	Het
Gm884	A	G	11: 103,542,120	S1232P	possibly damaging	Het
Gnao1	G	A	8: 93,966,999	D337N	probably benign	Het
Ifit1	T	A	19: 34,648,469	M335K	possibly damaging	Het
Ism1	T	C	2: 139,678,757	S30P	probably benign	Het
Itgax	A	G	7: 128,140,447	D677G	probably damaging	Het
Kansl1l	G	A	1: 66,725,922	A442V	probably damaging	Het
Kif13a	T	C	13: 46,771,524	I311M	probably damaging	Het
Lsm14b	T	A	2: 180,031,425	S84R	probably benign	Het
Lzts3	A	G	2: 130,636,288	Y297H	probably damaging	Het
Map4k3	A	G	17: 80,644,762	I205T	probably damaging	Het
Matn2	A	T	15: 34,410,165	N501I	probably damaging	Het
Mctp2	T	C	7: 72,103,177	E776G	probably damaging	Het
Mex3d	A	T	10: 80,382,587	N265K	probably damaging	Het
Myo5a	A	G	9: 75,203,833	T1534A	probably benign	Het
Ncoa7	T	C	10: 30,704,636	M35V	probably damaging	Het
Nek4	G	A	14: 30,957,079		probably null	Het
Ngrn	T	C	7: 80,261,933		probably null	Het
Nlrp1a	T	A	11: 71,123,020	Q468L	probably benign	Het
Olfr1450	A	C	19: 12,954,531	Q314P	probably benign	Het
Olfr743	T	A	14: 50,534,198	M262K	probably damaging	Het
Phtf2	T	C	5: 20,775,934	D433G	probably damaging	Het
Prdm13	G	A	4: 21,683,852	Q140*	probably null	Het
Prtg	G	A	9: 72,892,254	G778E	probably benign	Het
Pum3	T	C	19: 27,420,051	E308G	probably damaging	Het
Pwp1	T	G	10: 85,882,886	F306V	probably damaging	Het
Rab24	A	T	13: 55,321,576	Y27N	probably damaging	Het
Rnf215	T	C	11: 4,135,898	F126L	probably benign	Het
Samd13	A	T	3: 146,680,696		probably benign	Het
Serac1	T	A	17: 6,065,049	H213L	probably benign	Het
Slc45a3	A	G	1: 131,978,073	E278G	probably damaging	Het
Slit3	C	T	11: 35,700,236	R1292C	probably damaging	Het
Slx4	A	T	16: 4,000,951		probably null	Het
Smarca4	C	A	9: 21,647,430	T631K	probably benign	Het
Snx16	C	T	3: 10,434,481	R163Q	possibly damaging	Het
Stk40	T	C	4: 126,128,895	V140A	probably damaging	Het
Tcf12	A	T	9: 71,868,240	D409E	probably damaging	Het
Tgfbr2	G	T	9: 116,110,255	T168K	possibly damaging	Het
Ticam1	G	T	17: 56,271,703	H131N	probably damaging	Het
Ttn	C	A	2: 76,829,888	R7458I	possibly damaging	Het
Ttn	C	A	2: 76,713,511	E31298*	probably null	Het
Usp7	A	G	16: 8,712,102	V133A	possibly damaging	Het
Wbp1l	C	T	19: 46,654,180	R191*	probably null	Het
Wdfy4	T	C	14: 33,106,011	E1118G	probably damaging	Het
Zfp81	G	C	17: 33,336,845	P3A	probably damaging	Het
Znhit6	A	G	3: 145,576,933	K21R	possibly damaging	Het

Other mutations in Gp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00338:Gp2	APN	7	119454390	missense	probably damaging	0.96
IGL00818:Gp2	APN	7	119450127	missense	possibly damaging	0.82
IGL01830:Gp2	APN	7	119451542	missense	probably damaging	1.00
IGL02088:Gp2	APN	7	119454469	missense	probably damaging	1.00
IGL02284:Gp2	APN	7	119450183	missense	probably damaging	1.00
IGL02812:Gp2	APN	7	119452229	missense	probably benign	0.01
IGL03049:Gp2	APN	7	119450294	missense	possibly damaging	0.82
IGL03368:Gp2	APN	7	119452874	missense	probably damaging	1.00
IGL03369:Gp2	APN	7	119451560	missense	probably damaging	0.98
PIT4687001:Gp2	UTSW	7	119451578	missense	possibly damaging	0.48
R0179:Gp2	UTSW	7	119452317	missense	possibly damaging	0.81
R0367:Gp2	UTSW	7	119454568	missense	probably damaging	1.00
R0544:Gp2	UTSW	7	119454496	missense	probably benign	0.00
R0973:Gp2	UTSW	7	119454543	missense	probably damaging	1.00
R0973:Gp2	UTSW	7	119454543	missense	probably damaging	1.00
R0974:Gp2	UTSW	7	119454543	missense	probably damaging	1.00
R1413:Gp2	UTSW	7	119451630	missense	probably benign	0.15
R1557:Gp2	UTSW	7	119450079	missense	probably damaging	1.00
R1638:Gp2	UTSW	7	119451498	critical splice donor site	probably null
R1709:Gp2	UTSW	7	119451585	missense	probably null	1.00
R1932:Gp2	UTSW	7	119454232	missense	possibly damaging	0.81
R2109:Gp2	UTSW	7	119452932	missense	probably benign
R2159:Gp2	UTSW	7	119452284	missense	probably benign	0.06
R2285:Gp2	UTSW	7	119450085	missense	possibly damaging	0.82
R4657:Gp2	UTSW	7	119457168	missense	probably benign	0.38
R4829:Gp2	UTSW	7	119457184	missense	possibly damaging	0.56
R4854:Gp2	UTSW	7	119452199	missense	possibly damaging	0.72
R4927:Gp2	UTSW	7	119452895	missense	probably benign	0.00
R5022:Gp2	UTSW	7	119449114	missense	probably damaging	1.00
R5033:Gp2	UTSW	7	119454291	missense	probably damaging	0.99
R5443:Gp2	UTSW	7	119454598	missense	possibly damaging	0.60
R5444:Gp2	UTSW	7	119454598	missense	possibly damaging	0.60
R5681:Gp2	UTSW	7	119452294	missense	possibly damaging	0.92
R5732:Gp2	UTSW	7	119449108	missense	probably damaging	1.00
R6963:Gp2	UTSW	7	119452897	missense	probably benign	0.03
R7014:Gp2	UTSW	7	119451645	missense	probably damaging	1.00
R7087:Gp2	UTSW	7	119450232	missense	probably damaging	0.99
R7223:Gp2	UTSW	7	119451498	critical splice donor site	probably null
R7497:Gp2	UTSW	7	119454606	missense	probably damaging	1.00
R8165:Gp2	UTSW	7	119450152	missense	probably damaging	1.00
R8343:Gp2	UTSW	7	119442787	missense	probably benign	0.01
R8344:Gp2	UTSW	7	119442787	missense	probably benign	0.01
R8345:Gp2	UTSW	7	119442787	missense	probably benign	0.01
R8431:Gp2	UTSW	7	119442787	missense	probably benign	0.01
R8432:Gp2	UTSW	7	119442787	missense	probably benign	0.01
R8463:Gp2	UTSW	7	119454331	missense	probably damaging	1.00
R9169:Gp2	UTSW	7	119442706	missense	probably benign
R9439:Gp2	UTSW	7	119454210	missense	probably damaging	1.00
X0026:Gp2	UTSW	7	119442819	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- ATGTAGAGAGTCGACTGGGC -3'
(R):5'- TGATTAACCACCCCTAGATTACTTACC -3'

Sequencing Primer
(F):5'- CACCAATACAAAGAGACACTCACTGG -3'
(R):5'- GAGACATGTCCCAGAAACTGTGC -3'

Posted On

2017-03-31