Incidental Mutation 'R5964:Cog7'
ID 471949
Institutional Source Beutler Lab
Gene Symbol Cog7
Ensembl Gene ENSMUSG00000034951
Gene Name component of oligomeric golgi complex 7
Synonyms
MMRRC Submission 044149-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5964 (G1)
Quality Score 101
Status Validated
Chromosome 7
Chromosomal Location 121879363-121981711 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 121956029 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 304 (R304G)
Ref Sequence ENSEMBL: ENSMUSP00000058990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057576] [ENSMUST00000205438]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000057576
AA Change: R304G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000058990
Gene: ENSMUSG00000034951
AA Change: R304G

DomainStartEndE-ValueType
Pfam:COG7 2 767 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148634
Predicted Effect probably damaging
Transcript: ENSMUST00000205438
AA Change: R304G

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.4879 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.2%
Validation Efficiency 96% (87/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene resides in the golgi, and constitutes one of the 8 subunits of the conserved oligomeric Golgi (COG) complex, which is required for normal golgi morphology and localization. Mutations in this gene are associated with the congenital disorder of glycosylation type IIe.[provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam15 G A 3: 89,343,567 Q581* probably null Het
Agl A G 3: 116,793,774 V44A probably damaging Het
Alpk3 T A 7: 81,092,260 D608E possibly damaging Het
Aspm C A 1: 139,455,227 probably benign Het
Bbs2 T C 8: 94,068,367 N692S probably benign Het
Bend4 A G 5: 67,417,818 I240T probably benign Het
Casp8 G T 1: 58,833,736 R277L possibly damaging Het
Ccdc61 A T 7: 18,900,940 I123N probably damaging Het
Ccr9 T G 9: 123,779,434 I60M probably benign Het
Cd163 T A 6: 124,326,572 W1066R probably benign Het
Cd226 A T 18: 89,207,183 H68L probably benign Het
Cdkn3 T A 14: 46,767,217 C79S probably null Het
Cnnm1 A T 19: 43,469,723 E658V probably benign Het
Cpt1a T A 19: 3,365,760 V286E possibly damaging Het
Creg2 C A 1: 39,624,954 R212L probably benign Het
Cyp26a1 T G 19: 37,699,962 S311A probably damaging Het
Cyp2b10 T C 7: 25,926,223 Y484H probably benign Het
Cyp3a44 T A 5: 145,788,467 Y308F possibly damaging Het
Dlg5 A G 14: 24,164,089 V744A probably benign Het
Dlgap2 T A 8: 14,727,128 Y124* probably null Het
Dnah3 T C 7: 119,922,880 D4030G probably benign Het
Dnah5 A G 15: 28,458,584 T4456A possibly damaging Het
Dtx2 T A 5: 136,023,699 V347D probably benign Het
Gigyf2 C T 1: 87,407,167 T294M probably damaging Het
Gli3 C G 13: 15,726,162 S1378* probably null Het
Gm884 A G 11: 103,542,120 S1232P possibly damaging Het
Gnao1 G A 8: 93,966,999 D337N probably benign Het
Gp2 T A 7: 119,449,129 Q422L probably benign Het
Ifit1 T A 19: 34,648,469 M335K possibly damaging Het
Ism1 T C 2: 139,678,757 S30P probably benign Het
Itgax A G 7: 128,140,447 D677G probably damaging Het
Kansl1l G A 1: 66,725,922 A442V probably damaging Het
Kif13a T C 13: 46,771,524 I311M probably damaging Het
Lsm14b T A 2: 180,031,425 S84R probably benign Het
Lzts3 A G 2: 130,636,288 Y297H probably damaging Het
Map4k3 A G 17: 80,644,762 I205T probably damaging Het
Matn2 A T 15: 34,410,165 N501I probably damaging Het
Mctp2 T C 7: 72,103,177 E776G probably damaging Het
Mex3d A T 10: 80,382,587 N265K probably damaging Het
Myo5a A G 9: 75,203,833 T1534A probably benign Het
Ncoa7 T C 10: 30,704,636 M35V probably damaging Het
Nek4 G A 14: 30,957,079 probably null Het
Ngrn T C 7: 80,261,933 probably null Het
Nlrp1a T A 11: 71,123,020 Q468L probably benign Het
Olfr1450 A C 19: 12,954,531 Q314P probably benign Het
Olfr743 T A 14: 50,534,198 M262K probably damaging Het
Phtf2 T C 5: 20,775,934 D433G probably damaging Het
Prdm13 G A 4: 21,683,852 Q140* probably null Het
Prtg G A 9: 72,892,254 G778E probably benign Het
Pum3 T C 19: 27,420,051 E308G probably damaging Het
Pwp1 T G 10: 85,882,886 F306V probably damaging Het
Rab24 A T 13: 55,321,576 Y27N probably damaging Het
Rnf215 T C 11: 4,135,898 F126L probably benign Het
Samd13 A T 3: 146,680,696 probably benign Het
Serac1 T A 17: 6,065,049 H213L probably benign Het
Slc45a3 A G 1: 131,978,073 E278G probably damaging Het
Slit3 C T 11: 35,700,236 R1292C probably damaging Het
Slx4 A T 16: 4,000,951 probably null Het
Smarca4 C A 9: 21,647,430 T631K probably benign Het
Snx16 C T 3: 10,434,481 R163Q possibly damaging Het
Stk40 T C 4: 126,128,895 V140A probably damaging Het
Tcf12 A T 9: 71,868,240 D409E probably damaging Het
Tgfbr2 G T 9: 116,110,255 T168K possibly damaging Het
Ticam1 G T 17: 56,271,703 H131N probably damaging Het
Ttn C A 2: 76,829,888 R7458I possibly damaging Het
Ttn C A 2: 76,713,511 E31298* probably null Het
Usp7 A G 16: 8,712,102 V133A possibly damaging Het
Wbp1l C T 19: 46,654,180 R191* probably null Het
Wdfy4 T C 14: 33,106,011 E1118G probably damaging Het
Zfp81 G C 17: 33,336,845 P3A probably damaging Het
Znhit6 A G 3: 145,576,933 K21R possibly damaging Het
Other mutations in Cog7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02023:Cog7 APN 7 121943777 critical splice donor site probably null
IGL02094:Cog7 APN 7 121963247 missense probably benign 0.21
IGL02113:Cog7 APN 7 121925480 missense probably damaging 1.00
IGL02151:Cog7 APN 7 121943808 missense probably damaging 0.97
IGL02365:Cog7 APN 7 121977736 missense possibly damaging 0.56
IGL02398:Cog7 APN 7 121964209 missense probably damaging 1.00
IGL02732:Cog7 APN 7 121923367 missense probably benign 0.05
IGL02887:Cog7 APN 7 121943844 missense possibly damaging 0.83
R0143:Cog7 UTSW 7 121951164 missense probably damaging 1.00
R0446:Cog7 UTSW 7 121937072 missense probably benign
R0521:Cog7 UTSW 7 121941169 critical splice donor site probably null
R0526:Cog7 UTSW 7 121963271 splice site probably null
R0658:Cog7 UTSW 7 121956140 splice site probably benign
R0782:Cog7 UTSW 7 121943797 missense possibly damaging 0.86
R1029:Cog7 UTSW 7 121930529 critical splice donor site probably null
R1419:Cog7 UTSW 7 121955992 missense probably damaging 0.99
R1521:Cog7 UTSW 7 121930574 missense possibly damaging 0.57
R1639:Cog7 UTSW 7 121981419 missense probably damaging 1.00
R2023:Cog7 UTSW 7 121936970 missense probably damaging 0.99
R3896:Cog7 UTSW 7 121941169 critical splice donor site probably benign
R4240:Cog7 UTSW 7 121925484 missense possibly damaging 0.50
R4731:Cog7 UTSW 7 121964244 missense probably benign 0.00
R4732:Cog7 UTSW 7 121964244 missense probably benign 0.00
R4733:Cog7 UTSW 7 121964244 missense probably benign 0.00
R4838:Cog7 UTSW 7 121971381 missense probably damaging 1.00
R5001:Cog7 UTSW 7 121949886 missense probably damaging 1.00
R5237:Cog7 UTSW 7 121951221 missense probably damaging 1.00
R5353:Cog7 UTSW 7 121941247 splice site probably null
R5609:Cog7 UTSW 7 121925460 missense probably benign 0.12
R6544:Cog7 UTSW 7 121935743 missense probably damaging 0.99
R6784:Cog7 UTSW 7 121964293 splice site probably null
R7110:Cog7 UTSW 7 121935776 missense probably damaging 0.98
R7212:Cog7 UTSW 7 121977314 missense probably damaging 0.98
R7304:Cog7 UTSW 7 121937139 missense probably benign 0.04
R8185:Cog7 UTSW 7 121977746 missense probably damaging 1.00
R8207:Cog7 UTSW 7 121977292 missense possibly damaging 0.70
R8838:Cog7 UTSW 7 121949883 missense probably damaging 0.98
R9116:Cog7 UTSW 7 121971338 missense probably damaging 0.99
X0066:Cog7 UTSW 7 121977624 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGAGACACCGACTCTTTC -3'
(R):5'- TAGGGTCTGCCTTGGAACATC -3'

Sequencing Primer
(F):5'- TTCCCTTCCACAGTTACTAGAAACAG -3'
(R):5'- TCTGCCTTGGAACATCAGGAGAC -3'
Posted On 2017-03-31