Mutagenetix > Incidental Mutation

Incidental Mutation 'R5964:Itgax'

471950

Institutional Source

Beutler Lab

Gene Symbol

Itgax

Ensembl Gene

ENSMUSG00000030789

Gene Name

integrin alpha X

Synonyms

Cd11c, CD11C (p150) alpha polypeptide

MMRRC Submission

044149-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.097) question?

Stock #

R5964 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

128129547-128150657 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 128140447 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 677 (D677G)

Ref Sequence

ENSEMBL: ENSMUSP00000033053 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033053]

AlphaFold

Q9QXH4

Predicted Effect

probably damaging
Transcript: ENSMUST00000033053
AA Change: D677G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000033053
Gene: ENSMUSG00000030789
AA Change: D677G

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Int_alpha	33	83	1.28e1	SMART
VWA	150	331	8.36e-43	SMART
Int_alpha	402	451	3.67e-3	SMART
Int_alpha	455	512	1.29e-7	SMART
Int_alpha	518	574	5.72e-14	SMART
Int_alpha	581	635	1.55e-1	SMART
transmembrane domain	1115	1137	N/A	INTRINSIC
Pfam:Integrin_alpha	1138	1152	6.2e-7	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205408

Meta Mutation Damage Score

0.7696

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.2%

Validation Efficiency

96% (87/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the integrin alpha X chain protein. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This protein combines with the beta 2 chain (ITGB2) to form a leukocyte-specific integrin referred to as inactivated-C3b (iC3b) receptor 4 (CR4). The alpha X beta 2 complex seems to overlap the properties of the alpha M beta 2 integrin in the adherence of neutrophils and monocytes to stimulated endothelium cells, and in the phagocytosis of complement coated particles. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to bacterial infection, decreased susceptibility to experimental autoimmune encephalomyelitis (EAE), increased T cell proliferation, and an abnormal pattern of cytokine production during EAE. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam15	G	A	3: 89,343,567	Q581*	probably null	Het
Agl	A	G	3: 116,793,774	V44A	probably damaging	Het
Alpk3	T	A	7: 81,092,260	D608E	possibly damaging	Het
Aspm	C	A	1: 139,455,227		probably benign	Het
Bbs2	T	C	8: 94,068,367	N692S	probably benign	Het
Bend4	A	G	5: 67,417,818	I240T	probably benign	Het
Casp8	G	T	1: 58,833,736	R277L	possibly damaging	Het
Ccdc61	A	T	7: 18,900,940	I123N	probably damaging	Het
Ccr9	T	G	9: 123,779,434	I60M	probably benign	Het
Cd163	T	A	6: 124,326,572	W1066R	probably benign	Het
Cd226	A	T	18: 89,207,183	H68L	probably benign	Het
Cdkn3	T	A	14: 46,767,217	C79S	probably null	Het
Cnnm1	A	T	19: 43,469,723	E658V	probably benign	Het
Cog7	T	C	7: 121,956,029	R304G	probably damaging	Het
Cpt1a	T	A	19: 3,365,760	V286E	possibly damaging	Het
Creg2	C	A	1: 39,624,954	R212L	probably benign	Het
Cyp26a1	T	G	19: 37,699,962	S311A	probably damaging	Het
Cyp2b10	T	C	7: 25,926,223	Y484H	probably benign	Het
Cyp3a44	T	A	5: 145,788,467	Y308F	possibly damaging	Het
Dlg5	A	G	14: 24,164,089	V744A	probably benign	Het
Dlgap2	T	A	8: 14,727,128	Y124*	probably null	Het
Dnah3	T	C	7: 119,922,880	D4030G	probably benign	Het
Dnah5	A	G	15: 28,458,584	T4456A	possibly damaging	Het
Dtx2	T	A	5: 136,023,699	V347D	probably benign	Het
Gigyf2	C	T	1: 87,407,167	T294M	probably damaging	Het
Gli3	C	G	13: 15,726,162	S1378*	probably null	Het
Gm884	A	G	11: 103,542,120	S1232P	possibly damaging	Het
Gnao1	G	A	8: 93,966,999	D337N	probably benign	Het
Gp2	T	A	7: 119,449,129	Q422L	probably benign	Het
Ifit1	T	A	19: 34,648,469	M335K	possibly damaging	Het
Ism1	T	C	2: 139,678,757	S30P	probably benign	Het
Kansl1l	G	A	1: 66,725,922	A442V	probably damaging	Het
Kif13a	T	C	13: 46,771,524	I311M	probably damaging	Het
Lsm14b	T	A	2: 180,031,425	S84R	probably benign	Het
Lzts3	A	G	2: 130,636,288	Y297H	probably damaging	Het
Map4k3	A	G	17: 80,644,762	I205T	probably damaging	Het
Matn2	A	T	15: 34,410,165	N501I	probably damaging	Het
Mctp2	T	C	7: 72,103,177	E776G	probably damaging	Het
Mex3d	A	T	10: 80,382,587	N265K	probably damaging	Het
Myo5a	A	G	9: 75,203,833	T1534A	probably benign	Het
Ncoa7	T	C	10: 30,704,636	M35V	probably damaging	Het
Nek4	G	A	14: 30,957,079		probably null	Het
Ngrn	T	C	7: 80,261,933		probably null	Het
Nlrp1a	T	A	11: 71,123,020	Q468L	probably benign	Het
Olfr1450	A	C	19: 12,954,531	Q314P	probably benign	Het
Olfr743	T	A	14: 50,534,198	M262K	probably damaging	Het
Phtf2	T	C	5: 20,775,934	D433G	probably damaging	Het
Prdm13	G	A	4: 21,683,852	Q140*	probably null	Het
Prtg	G	A	9: 72,892,254	G778E	probably benign	Het
Pum3	T	C	19: 27,420,051	E308G	probably damaging	Het
Pwp1	T	G	10: 85,882,886	F306V	probably damaging	Het
Rab24	A	T	13: 55,321,576	Y27N	probably damaging	Het
Rnf215	T	C	11: 4,135,898	F126L	probably benign	Het
Samd13	A	T	3: 146,680,696		probably benign	Het
Serac1	T	A	17: 6,065,049	H213L	probably benign	Het
Slc45a3	A	G	1: 131,978,073	E278G	probably damaging	Het
Slit3	C	T	11: 35,700,236	R1292C	probably damaging	Het
Slx4	A	T	16: 4,000,951		probably null	Het
Smarca4	C	A	9: 21,647,430	T631K	probably benign	Het
Snx16	C	T	3: 10,434,481	R163Q	possibly damaging	Het
Stk40	T	C	4: 126,128,895	V140A	probably damaging	Het
Tcf12	A	T	9: 71,868,240	D409E	probably damaging	Het
Tgfbr2	G	T	9: 116,110,255	T168K	possibly damaging	Het
Ticam1	G	T	17: 56,271,703	H131N	probably damaging	Het
Ttn	C	A	2: 76,713,511	E31298*	probably null	Het
Ttn	C	A	2: 76,829,888	R7458I	possibly damaging	Het
Usp7	A	G	16: 8,712,102	V133A	possibly damaging	Het
Wbp1l	C	T	19: 46,654,180	R191*	probably null	Het
Wdfy4	T	C	14: 33,106,011	E1118G	probably damaging	Het
Zfp81	G	C	17: 33,336,845	P3A	probably damaging	Het
Znhit6	A	G	3: 145,576,933	K21R	possibly damaging	Het

Other mutations in Itgax

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Itgax	APN	7	128135326	missense	probably damaging	1.00
IGL00325:Itgax	APN	7	128148309	missense	possibly damaging	0.69
IGL01155:Itgax	APN	7	128145035	missense	probably benign	0.00
IGL01461:Itgax	APN	7	128135018	missense	probably damaging	1.00
IGL01508:Itgax	APN	7	128144818	missense	probably damaging	1.00
IGL01549:Itgax	APN	7	128131206	splice site	probably null
IGL01864:Itgax	APN	7	128133763	missense	probably benign	0.00
IGL02094:Itgax	APN	7	128131473	missense	probably damaging	1.00
IGL02364:Itgax	APN	7	128139982	missense	possibly damaging	0.89
IGL02969:Itgax	APN	7	128149123	missense	probably benign
IGL03406:Itgax	APN	7	128149198	missense	possibly damaging	0.93
Adendritic	UTSW	7	128148572	nonsense	probably null
PIT4651001:Itgax	UTSW	7	128149110	missense	probably benign	0.11
R0366:Itgax	UTSW	7	128149089	splice site	probably benign
R0763:Itgax	UTSW	7	128147940	splice site	probably benign
R1072:Itgax	UTSW	7	128150144	missense	probably damaging	0.96
R1659:Itgax	UTSW	7	128130891	missense	probably benign	0.15
R2019:Itgax	UTSW	7	128148526	missense	probably benign
R2418:Itgax	UTSW	7	128142333	missense	probably damaging	0.98
R3027:Itgax	UTSW	7	128148572	nonsense	probably null
R3846:Itgax	UTSW	7	128133767	missense	probably damaging	1.00
R3938:Itgax	UTSW	7	128136273	missense	possibly damaging	0.73
R4021:Itgax	UTSW	7	128133139	critical splice donor site	probably null
R4027:Itgax	UTSW	7	128141266	missense	possibly damaging	0.75
R4163:Itgax	UTSW	7	128144700	missense	probably benign	0.00
R4923:Itgax	UTSW	7	128148528	missense	probably benign
R5259:Itgax	UTSW	7	128148278	missense	probably damaging	0.99
R5333:Itgax	UTSW	7	128142283	missense	probably damaging	1.00
R5347:Itgax	UTSW	7	128141302	missense	probably benign	0.08
R5679:Itgax	UTSW	7	128134990	missense	probably benign	0.00
R5725:Itgax	UTSW	7	128147861	missense	possibly damaging	0.63
R5733:Itgax	UTSW	7	128140475	missense	probably damaging	0.99
R5750:Itgax	UTSW	7	128144706	missense	probably benign	0.32
R6004:Itgax	UTSW	7	128131452	missense	probably damaging	0.96
R6168:Itgax	UTSW	7	128133097	missense	probably damaging	0.99
R6212:Itgax	UTSW	7	128130332	missense	possibly damaging	0.52
R6212:Itgax	UTSW	7	128147853	missense	probably benign	0.16
R6480:Itgax	UTSW	7	128148599	missense	probably benign	0.12
R6484:Itgax	UTSW	7	128133718	missense	probably benign	0.13
R6796:Itgax	UTSW	7	128135064	missense	probably damaging	1.00
R6844:Itgax	UTSW	7	128147934	splice site	probably null
R7287:Itgax	UTSW	7	128148505	missense	probably damaging	1.00
R7365:Itgax	UTSW	7	128135309	missense	probably damaging	1.00
R7421:Itgax	UTSW	7	128140432	missense	probably damaging	1.00
R7599:Itgax	UTSW	7	128148090	missense	probably damaging	0.99
R7710:Itgax	UTSW	7	128135856	missense	probably benign	0.04
R7964:Itgax	UTSW	7	128140418	critical splice acceptor site	probably null
R8220:Itgax	UTSW	7	128130918	missense	probably benign	0.00
R8730:Itgax	UTSW	7	128139894	critical splice acceptor site	probably null
R8742:Itgax	UTSW	7	128144623	missense	probably benign	0.28
R8812:Itgax	UTSW	7	128133807	missense	probably damaging	1.00
R8871:Itgax	UTSW	7	128136051	missense	probably damaging	1.00
R9147:Itgax	UTSW	7	128148741	missense	possibly damaging	0.74
R9149:Itgax	UTSW	7	128131469	missense	probably benign	0.01
R9310:Itgax	UTSW	7	128142260	nonsense	probably null
R9376:Itgax	UTSW	7	128148763	missense	possibly damaging	0.94
R9377:Itgax	UTSW	7	128133677	missense	probably benign	0.03
R9641:Itgax	UTSW	7	128141980	missense	probably damaging	1.00
R9650:Itgax	UTSW	7	128135763	missense	probably benign	0.24
R9709:Itgax	UTSW	7	128136328	missense	probably damaging	1.00
X0061:Itgax	UTSW	7	128129607	start gained	probably benign
Z1176:Itgax	UTSW	7	128144872	missense	probably benign	0.24
Z1177:Itgax	UTSW	7	128148062	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- TGAGCAGACACTGAGTGATGC -3'
(R):5'- GGAAAGCTCAGAACATGCTG -3'

Sequencing Primer
(F):5'- GTGATGCCACTGTCTGCC -3'
(R):5'- GAACTTGCTTCCAGTTCCCAAACG -3'

Posted On

2017-03-31