Mutagenetix > Incidental Mutations

Incidental Mutation 'R5964:Bbs2'

471953

Institutional Source

Beutler Lab

Gene Symbol

Bbs2

Ensembl Gene

ENSMUSG00000031755

Gene Name

Bardet-Biedl syndrome 2 (human)

Synonyms

2410125H22Rik

MMRRC Submission

044149-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.694) question?

Stock #

R5964 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

94067954-94098928 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 94068367 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 692 (N692S)

Ref Sequence

ENSEMBL: ENSMUSP00000034206 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034206] [ENSMUST00000060632] [ENSMUST00000093301] [ENSMUST00000109556]

Predicted Effect

probably benign
Transcript: ENSMUST00000034206
AA Change: N692S

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000034206
Gene: ENSMUSG00000031755
AA Change: N692S

Domain	Start	End	E-Value	Type
Pfam:BBS2_N	20	161	1.4e-62	PFAM
Pfam:BBS2_Mid	162	272	6.9e-50	PFAM
Pfam:BBS2_C	276	715	2.6e-193	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000060632

SMART Domains

Protein: ENSMUSP00000051430
Gene: ENSMUSG00000033009

Domain	Start	End	E-Value	Type
P4Hc	46	223	4.87e-26	SMART
Pfam:Ofd1_CTDD	246	513	1.4e-50	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000093301

SMART Domains

Protein: ENSMUSP00000090991
Gene: ENSMUSG00000033009

Domain	Start	End	E-Value	Type
P4Hc	61	228	2.6e-12	SMART
low complexity region	328	353	N/A	INTRINSIC
low complexity region	375	389	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000109556

SMART Domains

Protein: ENSMUSP00000105183
Gene: ENSMUSG00000033009

Domain	Start	End	E-Value	Type
P4Hc	61	238	4.87e-26	SMART
Pfam:Ofd1_CTDD	261	528	7.2e-51	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000170208

Meta Mutation Damage Score

0.0580

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.2%

Validation Efficiency

96% (87/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Bardet-Biedl syndrome (BBS) gene family. Bardet-Biedl syndrome is an autosomal recessive disorder characterized by severe pigmentary retinopathy, obesity, polydactyly, renal malformation and mental retardation. The proteins encoded by BBS gene family members are structurally diverse and the similar phenotypes exhibited by mutations in BBS gene family members is likely due to their shared roles in cilia formation and function. Many BBS proteins localize to the basal bodies, ciliary axonemes, and pericentriolar regions of cells. BBS proteins may also be involved in intracellular trafficking via microtubule-related transport. The protein encoded by this gene forms a multiprotein BBSome complex with seven other BBS proteins.[provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygous null mice display obesity associated with polyphagia, retinopathy associated with mislocalization of rhodopsin, cilia defects, renal cysts, male sterility, abnormal brain neuroanatomy, reduced salivation and acoustic startle response, an olfactory deficit and abnormal social interaction. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam15	G	A	3: 89,343,567	Q581*	probably null	Het
Agl	A	G	3: 116,793,774	V44A	probably damaging	Het
Alpk3	T	A	7: 81,092,260	D608E	possibly damaging	Het
Aspm	C	A	1: 139,455,227		probably benign	Het
Bend4	A	G	5: 67,417,818	I240T	probably benign	Het
Casp8	G	T	1: 58,833,736	R277L	possibly damaging	Het
Ccdc61	A	T	7: 18,900,940	I123N	probably damaging	Het
Ccr9	T	G	9: 123,779,434	I60M	probably benign	Het
Cd163	T	A	6: 124,326,572	W1066R	probably benign	Het
Cd226	A	T	18: 89,207,183	H68L	probably benign	Het
Cdkn3	T	A	14: 46,767,217	C79S	probably null	Het
Cnnm1	A	T	19: 43,469,723	E658V	probably benign	Het
Cog7	T	C	7: 121,956,029	R304G	probably damaging	Het
Cpt1a	T	A	19: 3,365,760	V286E	possibly damaging	Het
Creg2	C	A	1: 39,624,954	R212L	probably benign	Het
Cyp26a1	T	G	19: 37,699,962	S311A	probably damaging	Het
Cyp2b10	T	C	7: 25,926,223	Y484H	probably benign	Het
Cyp3a44	T	A	5: 145,788,467	Y308F	possibly damaging	Het
Dlg5	A	G	14: 24,164,089	V744A	probably benign	Het
Dlgap2	T	A	8: 14,727,128	Y124*	probably null	Het
Dnah3	T	C	7: 119,922,880	D4030G	probably benign	Het
Dnah5	A	G	15: 28,458,584	T4456A	possibly damaging	Het
Dtx2	T	A	5: 136,023,699	V347D	probably benign	Het
Gigyf2	C	T	1: 87,407,167	T294M	probably damaging	Het
Gli3	C	G	13: 15,726,162	S1378*	probably null	Het
Gm884	A	G	11: 103,542,120	S1232P	possibly damaging	Het
Gnao1	G	A	8: 93,966,999	D337N	probably benign	Het
Gp2	T	A	7: 119,449,129	Q422L	probably benign	Het
Ifit1	T	A	19: 34,648,469	M335K	possibly damaging	Het
Ism1	T	C	2: 139,678,757	S30P	probably benign	Het
Itgax	A	G	7: 128,140,447	D677G	probably damaging	Het
Kansl1l	G	A	1: 66,725,922	A442V	probably damaging	Het
Kif13a	T	C	13: 46,771,524	I311M	probably damaging	Het
Lsm14b	T	A	2: 180,031,425	S84R	probably benign	Het
Lzts3	A	G	2: 130,636,288	Y297H	probably damaging	Het
Map4k3	A	G	17: 80,644,762	I205T	probably damaging	Het
Matn2	A	T	15: 34,410,165	N501I	probably damaging	Het
Mctp2	T	C	7: 72,103,177	E776G	probably damaging	Het
Mex3d	A	T	10: 80,382,587	N265K	probably damaging	Het
Myo5a	A	G	9: 75,203,833	T1534A	probably benign	Het
Ncoa7	T	C	10: 30,704,636	M35V	probably damaging	Het
Nek4	G	A	14: 30,957,079		probably null	Het
Ngrn	T	C	7: 80,261,933		probably null	Het
Nlrp1a	T	A	11: 71,123,020	Q468L	probably benign	Het
Olfr1450	A	C	19: 12,954,531	Q314P	probably benign	Het
Olfr743	T	A	14: 50,534,198	M262K	probably damaging	Het
Phtf2	T	C	5: 20,775,934	D433G	probably damaging	Het
Prdm13	G	A	4: 21,683,852	Q140*	probably null	Het
Prtg	G	A	9: 72,892,254	G778E	probably benign	Het
Pum3	T	C	19: 27,420,051	E308G	probably damaging	Het
Pwp1	T	G	10: 85,882,886	F306V	probably damaging	Het
Rab24	A	T	13: 55,321,576	Y27N	probably damaging	Het
Rnf215	T	C	11: 4,135,898	F126L	probably benign	Het
Samd13	A	T	3: 146,680,696		probably benign	Het
Serac1	T	A	17: 6,065,049	H213L	probably benign	Het
Slc45a3	A	G	1: 131,978,073	E278G	probably damaging	Het
Slit3	C	T	11: 35,700,236	R1292C	probably damaging	Het
Slx4	A	T	16: 4,000,951		probably null	Het
Smarca4	C	A	9: 21,647,430	T631K	probably benign	Het
Snx16	C	T	3: 10,434,481	R163Q	possibly damaging	Het
Stk40	T	C	4: 126,128,895	V140A	probably damaging	Het
Tcf12	A	T	9: 71,868,240	D409E	probably damaging	Het
Tgfbr2	G	T	9: 116,110,255	T168K	possibly damaging	Het
Ticam1	G	T	17: 56,271,703	H131N	probably damaging	Het
Ttn	C	A	2: 76,713,511	E31298*	probably null	Het
Ttn	C	A	2: 76,829,888	R7458I	possibly damaging	Het
Usp7	A	G	16: 8,712,102	V133A	possibly damaging	Het
Wbp1l	C	T	19: 46,654,180	R191*	probably null	Het
Wdfy4	T	C	14: 33,106,011	E1118G	probably damaging	Het
Zfp81	G	C	17: 33,336,845	P3A	probably damaging	Het
Znhit6	A	G	3: 145,576,933	K21R	possibly damaging	Het

Other mutations in Bbs2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00678:Bbs2	APN	8	94089167	critical splice acceptor site	probably null
IGL02250:Bbs2	APN	8	94092426	missense	probably benign	0.22
IGL02427:Bbs2	APN	8	94081118	missense	possibly damaging	0.92
IGL02810:Bbs2	APN	8	94086911	missense	probably benign	0.00
IGL02850:Bbs2	APN	8	94077082	missense	probably benign
IGL03050:Bbs2	APN	8	94074413	splice site	probably benign
IGL03292:Bbs2	APN	8	94075121	critical splice donor site	probably null
rolie	UTSW	8	94082364	missense	probably damaging	0.96
BB007:Bbs2	UTSW	8	94069997	missense	probably damaging	1.00
BB017:Bbs2	UTSW	8	94069997	missense	probably damaging	1.00
R0755:Bbs2	UTSW	8	94082080	missense	probably benign	0.22
R0835:Bbs2	UTSW	8	94075259	missense	probably damaging	1.00
R1404:Bbs2	UTSW	8	94081999	missense	probably null	0.01
R1404:Bbs2	UTSW	8	94081999	missense	probably null	0.01
R1513:Bbs2	UTSW	8	94089844	missense	possibly damaging	0.94
R1972:Bbs2	UTSW	8	94081177	splice site	probably benign
R4648:Bbs2	UTSW	8	94080879	missense	probably damaging	1.00
R4876:Bbs2	UTSW	8	94070160	unclassified	probably benign
R4911:Bbs2	UTSW	8	94089115	missense	probably damaging	1.00
R4966:Bbs2	UTSW	8	94080807	missense	probably damaging	1.00
R4982:Bbs2	UTSW	8	94082354	critical splice donor site	probably null
R5202:Bbs2	UTSW	8	94092414	nonsense	probably null
R5347:Bbs2	UTSW	8	94092550	missense	probably damaging	0.98
R5364:Bbs2	UTSW	8	94074395	missense	probably benign	0.00
R5538:Bbs2	UTSW	8	94089763	missense	probably damaging	1.00
R5685:Bbs2	UTSW	8	94087433	missense	probably damaging	1.00
R5918:Bbs2	UTSW	8	94098303	missense	probably damaging	0.98
R5963:Bbs2	UTSW	8	94081031	missense	probably benign	0.02
R5991:Bbs2	UTSW	8	94098286	missense	probably benign	0.24
R6050:Bbs2	UTSW	8	94092532	missense	probably damaging	1.00
R6172:Bbs2	UTSW	8	94087411	missense	probably benign	0.02
R6241:Bbs2	UTSW	8	94098235	critical splice donor site	probably null
R6578:Bbs2	UTSW	8	94077041	missense	probably null	0.00
R7330:Bbs2	UTSW	8	94087405	missense	possibly damaging	0.78
R7404:Bbs2	UTSW	8	94082364	missense	probably damaging	0.96
R7775:Bbs2	UTSW	8	94089760	critical splice donor site	probably null
R7778:Bbs2	UTSW	8	94089760	critical splice donor site	probably null
R7824:Bbs2	UTSW	8	94089760	critical splice donor site	probably null
R7895:Bbs2	UTSW	8	94081136	missense	probably damaging	1.00
R7930:Bbs2	UTSW	8	94069997	missense	probably damaging	1.00
R8004:Bbs2	UTSW	8	94082490	missense	possibly damaging	0.95
R8084:Bbs2	UTSW	8	94087428	missense	probably damaging	1.00
R8305:Bbs2	UTSW	8	94074325	missense	probably damaging	1.00
R8545:Bbs2	UTSW	8	94086724	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GGTTTCATCCTTAGCAGCTGG -3'
(R):5'- GGTTTTATGCTGTCTTCAAACTGTC -3'

Sequencing Primer
(F):5'- CATCCTTAGCAGCTGGATGCC -3'
(R):5'- TGGAACTCACTCTGTAGACCAGG -3'

Posted On

2017-03-31