Mutagenetix > Incidental Mutation

Incidental Mutation 'R5964:Smarca4'

471954

Institutional Source

Beutler Lab

Gene Symbol

Smarca4

Ensembl Gene

ENSMUSG00000032187

Gene Name

SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4

Synonyms

SNF2beta, SW1/SNF, b2b508.1Clo, Brg1, b2b692Clo

MMRRC Submission

044149-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5964 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

21616169-21704230 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 21647430 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 631 (T631K)

Ref Sequence

ENSEMBL: ENSMUSP00000133922 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034707] [ENSMUST00000098948] [ENSMUST00000174008]

AlphaFold

Q3TKT4

Predicted Effect

probably benign
Transcript: ENSMUST00000034707
AA Change: T631K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000034707
Gene: ENSMUSG00000032187
AA Change: T631K

Domain	Start	End	E-Value	Type
low complexity region	6	58	N/A	INTRINSIC
low complexity region	130	153	N/A	INTRINSIC
QLQ	170	206	3.98e-14	SMART
low complexity region	221	247	N/A	INTRINSIC
low complexity region	252	289	N/A	INTRINSIC
low complexity region	304	330	N/A	INTRINSIC
low complexity region	407	418	N/A	INTRINSIC
HSA	460	532	2e-27	SMART
coiled coil region	563	595	N/A	INTRINSIC
BRK	612	656	5.17e-21	SMART
low complexity region	657	672	N/A	INTRINSIC
low complexity region	691	702	N/A	INTRINSIC
DEXDc	750	942	5.17e-38	SMART
Blast:DEXDc	953	985	7e-10	BLAST
low complexity region	1019	1034	N/A	INTRINSIC
HELICc	1110	1194	7.27e-24	SMART
low complexity region	1252	1267	N/A	INTRINSIC
SnAC	1288	1356	2.8e-29	SMART
low complexity region	1360	1385	N/A	INTRINSIC
low complexity region	1388	1398	N/A	INTRINSIC
BROMO	1422	1533	4.19e-42	SMART
low complexity region	1534	1557	N/A	INTRINSIC
low complexity region	1578	1588	N/A	INTRINSIC
low complexity region	1594	1614	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000098948
AA Change: T631K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000096547
Gene: ENSMUSG00000032187
AA Change: T631K

Domain	Start	End	E-Value	Type
low complexity region	6	58	N/A	INTRINSIC
low complexity region	130	153	N/A	INTRINSIC
QLQ	170	206	3.98e-14	SMART
low complexity region	221	247	N/A	INTRINSIC
low complexity region	252	289	N/A	INTRINSIC
low complexity region	304	330	N/A	INTRINSIC
low complexity region	407	418	N/A	INTRINSIC
HSA	460	532	2e-27	SMART
coiled coil region	563	595	N/A	INTRINSIC
BRK	612	656	5.17e-21	SMART
low complexity region	657	672	N/A	INTRINSIC
low complexity region	691	702	N/A	INTRINSIC
DEXDc	750	942	5.17e-38	SMART
Blast:DEXDc	953	985	7e-10	BLAST
low complexity region	1019	1034	N/A	INTRINSIC
HELICc	1110	1194	7.27e-24	SMART
low complexity region	1252	1267	N/A	INTRINSIC
SnAC	1288	1356	2.8e-29	SMART
low complexity region	1363	1388	N/A	INTRINSIC
low complexity region	1391	1401	N/A	INTRINSIC
BROMO	1425	1536	4.19e-42	SMART
low complexity region	1537	1560	N/A	INTRINSIC
low complexity region	1581	1591	N/A	INTRINSIC
low complexity region	1597	1617	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000172996
AA Change: T435K

SMART Domains

Protein: ENSMUSP00000133535
Gene: ENSMUSG00000032187
AA Change: T435K

Domain	Start	End	E-Value	Type
low complexity region	26	52	N/A	INTRINSIC
low complexity region	57	94	N/A	INTRINSIC
low complexity region	109	135	N/A	INTRINSIC
low complexity region	212	223	N/A	INTRINSIC
HSA	265	337	2e-27	SMART
coiled coil region	367	399	N/A	INTRINSIC
BRK	417	461	5.17e-21	SMART
low complexity region	462	477	N/A	INTRINSIC
low complexity region	496	507	N/A	INTRINSIC
DEXDc	555	747	5.17e-38	SMART
Blast:DEXDc	758	790	6e-10	BLAST
low complexity region	824	839	N/A	INTRINSIC
HELICc	915	999	7.27e-24	SMART
low complexity region	1088	1105	N/A	INTRINSIC
SnAC	1126	1194	2.8e-29	SMART
low complexity region	1201	1226	N/A	INTRINSIC
low complexity region	1229	1239	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000174008
AA Change: T631K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000133922
Gene: ENSMUSG00000032187
AA Change: T631K

Domain	Start	End	E-Value	Type
low complexity region	6	58	N/A	INTRINSIC
low complexity region	130	153	N/A	INTRINSIC
QLQ	170	206	3.98e-14	SMART
low complexity region	221	247	N/A	INTRINSIC
low complexity region	252	289	N/A	INTRINSIC
low complexity region	304	330	N/A	INTRINSIC
low complexity region	407	418	N/A	INTRINSIC
HSA	460	532	2e-27	SMART
coiled coil region	563	595	N/A	INTRINSIC
BRK	612	656	5.17e-21	SMART
low complexity region	657	672	N/A	INTRINSIC
low complexity region	691	702	N/A	INTRINSIC
DEXDc	750	942	5.17e-38	SMART
Blast:DEXDc	953	985	7e-10	BLAST
low complexity region	1019	1034	N/A	INTRINSIC
HELICc	1110	1194	7.27e-24	SMART
low complexity region	1252	1267	N/A	INTRINSIC
SnAC	1288	1356	2.8e-29	SMART
low complexity region	1360	1385	N/A	INTRINSIC
low complexity region	1388	1398	N/A	INTRINSIC
BROMO	1422	1532	1.36e-41	SMART
low complexity region	1533	1556	N/A	INTRINSIC
low complexity region	1577	1587	N/A	INTRINSIC
low complexity region	1593	1613	N/A	INTRINSIC

Meta Mutation Damage Score

0.0888

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.2%

Validation Efficiency

96% (87/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins and is similar to the brahma protein of Drosophila. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. In addition, this protein can bind BRCA1, as well as regulate the expression of the tumorigenic protein CD44. Mutations in this gene cause rhabdoid tumor predisposition syndrome type 2. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes for a null allele die in utero before implantation. Embryos heterozygous for this null allele and an ENU-induced allele show impaired definitive erythropoiesis, anemia and lethality during organogenesis. Heterozygotes for a different null allele show cyanosis and cardiovascular defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam15	G	A	3: 89,343,567	Q581*	probably null	Het
Agl	A	G	3: 116,793,774	V44A	probably damaging	Het
Alpk3	T	A	7: 81,092,260	D608E	possibly damaging	Het
Aspm	C	A	1: 139,455,227		probably benign	Het
Bbs2	T	C	8: 94,068,367	N692S	probably benign	Het
Bend4	A	G	5: 67,417,818	I240T	probably benign	Het
Casp8	G	T	1: 58,833,736	R277L	possibly damaging	Het
Ccdc61	A	T	7: 18,900,940	I123N	probably damaging	Het
Ccr9	T	G	9: 123,779,434	I60M	probably benign	Het
Cd163	T	A	6: 124,326,572	W1066R	probably benign	Het
Cd226	A	T	18: 89,207,183	H68L	probably benign	Het
Cdkn3	T	A	14: 46,767,217	C79S	probably null	Het
Cnnm1	A	T	19: 43,469,723	E658V	probably benign	Het
Cog7	T	C	7: 121,956,029	R304G	probably damaging	Het
Cpt1a	T	A	19: 3,365,760	V286E	possibly damaging	Het
Creg2	C	A	1: 39,624,954	R212L	probably benign	Het
Cyp26a1	T	G	19: 37,699,962	S311A	probably damaging	Het
Cyp2b10	T	C	7: 25,926,223	Y484H	probably benign	Het
Cyp3a44	T	A	5: 145,788,467	Y308F	possibly damaging	Het
Dlg5	A	G	14: 24,164,089	V744A	probably benign	Het
Dlgap2	T	A	8: 14,727,128	Y124*	probably null	Het
Dnah3	T	C	7: 119,922,880	D4030G	probably benign	Het
Dnah5	A	G	15: 28,458,584	T4456A	possibly damaging	Het
Dtx2	T	A	5: 136,023,699	V347D	probably benign	Het
Gigyf2	C	T	1: 87,407,167	T294M	probably damaging	Het
Gli3	C	G	13: 15,726,162	S1378*	probably null	Het
Gm884	A	G	11: 103,542,120	S1232P	possibly damaging	Het
Gnao1	G	A	8: 93,966,999	D337N	probably benign	Het
Gp2	T	A	7: 119,449,129	Q422L	probably benign	Het
Ifit1	T	A	19: 34,648,469	M335K	possibly damaging	Het
Ism1	T	C	2: 139,678,757	S30P	probably benign	Het
Itgax	A	G	7: 128,140,447	D677G	probably damaging	Het
Kansl1l	G	A	1: 66,725,922	A442V	probably damaging	Het
Kif13a	T	C	13: 46,771,524	I311M	probably damaging	Het
Lsm14b	T	A	2: 180,031,425	S84R	probably benign	Het
Lzts3	A	G	2: 130,636,288	Y297H	probably damaging	Het
Map4k3	A	G	17: 80,644,762	I205T	probably damaging	Het
Matn2	A	T	15: 34,410,165	N501I	probably damaging	Het
Mctp2	T	C	7: 72,103,177	E776G	probably damaging	Het
Mex3d	A	T	10: 80,382,587	N265K	probably damaging	Het
Myo5a	A	G	9: 75,203,833	T1534A	probably benign	Het
Ncoa7	T	C	10: 30,704,636	M35V	probably damaging	Het
Nek4	G	A	14: 30,957,079		probably null	Het
Ngrn	T	C	7: 80,261,933		probably null	Het
Nlrp1a	T	A	11: 71,123,020	Q468L	probably benign	Het
Olfr1450	A	C	19: 12,954,531	Q314P	probably benign	Het
Olfr743	T	A	14: 50,534,198	M262K	probably damaging	Het
Phtf2	T	C	5: 20,775,934	D433G	probably damaging	Het
Prdm13	G	A	4: 21,683,852	Q140*	probably null	Het
Prtg	G	A	9: 72,892,254	G778E	probably benign	Het
Pum3	T	C	19: 27,420,051	E308G	probably damaging	Het
Pwp1	T	G	10: 85,882,886	F306V	probably damaging	Het
Rab24	A	T	13: 55,321,576	Y27N	probably damaging	Het
Rnf215	T	C	11: 4,135,898	F126L	probably benign	Het
Samd13	A	T	3: 146,680,696		probably benign	Het
Serac1	T	A	17: 6,065,049	H213L	probably benign	Het
Slc45a3	A	G	1: 131,978,073	E278G	probably damaging	Het
Slit3	C	T	11: 35,700,236	R1292C	probably damaging	Het
Slx4	A	T	16: 4,000,951		probably null	Het
Snx16	C	T	3: 10,434,481	R163Q	possibly damaging	Het
Stk40	T	C	4: 126,128,895	V140A	probably damaging	Het
Tcf12	A	T	9: 71,868,240	D409E	probably damaging	Het
Tgfbr2	G	T	9: 116,110,255	T168K	possibly damaging	Het
Ticam1	G	T	17: 56,271,703	H131N	probably damaging	Het
Ttn	C	A	2: 76,829,888	R7458I	possibly damaging	Het
Ttn	C	A	2: 76,713,511	E31298*	probably null	Het
Usp7	A	G	16: 8,712,102	V133A	possibly damaging	Het
Wbp1l	C	T	19: 46,654,180	R191*	probably null	Het
Wdfy4	T	C	14: 33,106,011	E1118G	probably damaging	Het
Zfp81	G	C	17: 33,336,845	P3A	probably damaging	Het
Znhit6	A	G	3: 145,576,933	K21R	possibly damaging	Het

Other mutations in Smarca4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01380:Smarca4	APN	9	21679073	missense	probably benign	0.30
IGL01694:Smarca4	APN	9	21665870	missense	probably damaging	1.00
IGL02147:Smarca4	APN	9	21635703	missense	probably damaging	0.98
IGL02417:Smarca4	APN	9	21701090	missense	probably damaging	1.00
IGL02421:Smarca4	APN	9	21639239	missense	probably damaging	1.00
IGL02550:Smarca4	APN	9	21686122	missense	probably benign	0.25
IGL02794:Smarca4	APN	9	21673342	splice site	probably benign
IGL03030:Smarca4	APN	9	21635836	missense	probably benign	0.14
IGL03037:Smarca4	APN	9	21632935	unclassified	probably benign
IGL03069:Smarca4	APN	9	21635836	missense	probably benign	0.14
IGL03355:Smarca4	APN	9	21635836	missense	probably benign	0.14
R0123:Smarca4	UTSW	9	21637324	missense	probably damaging	1.00
R0134:Smarca4	UTSW	9	21637324	missense	probably damaging	1.00
R0230:Smarca4	UTSW	9	21700872	missense	probably damaging	0.99
R0269:Smarca4	UTSW	9	21636201	missense	probably benign	0.09
R0631:Smarca4	UTSW	9	21658984	splice site	probably benign
R0665:Smarca4	UTSW	9	21700943	small deletion	probably benign
R0726:Smarca4	UTSW	9	21700139	critical splice donor site	probably null
R0801:Smarca4	UTSW	9	21642554	missense	possibly damaging	0.81
R0918:Smarca4	UTSW	9	21636215	missense	probably benign	0.16
R1411:Smarca4	UTSW	9	21658955	missense	probably damaging	1.00
R1604:Smarca4	UTSW	9	21700943	small deletion	probably benign
R1768:Smarca4	UTSW	9	21701183	missense	possibly damaging	0.56
R2004:Smarca4	UTSW	9	21677480	missense	probably damaging	1.00
R2031:Smarca4	UTSW	9	21686062	missense	possibly damaging	0.68
R2211:Smarca4	UTSW	9	21686029	missense	probably damaging	1.00
R2512:Smarca4	UTSW	9	21635698	missense	possibly damaging	0.95
R2875:Smarca4	UTSW	9	21642580	missense	possibly damaging	0.55
R3786:Smarca4	UTSW	9	21672059	missense	possibly damaging	0.94
R4829:Smarca4	UTSW	9	21639327	missense	probably damaging	0.97
R5084:Smarca4	UTSW	9	21660763	missense	probably damaging	1.00
R5222:Smarca4	UTSW	9	21655706	missense	probably benign	0.01
R5785:Smarca4	UTSW	9	21686026	missense	probably damaging	0.99
R5844:Smarca4	UTSW	9	21677942	intron	probably benign
R6001:Smarca4	UTSW	9	21632909	unclassified	probably benign
R6072:Smarca4	UTSW	9	21700121	missense	probably damaging	1.00
R6254:Smarca4	UTSW	9	21699877	missense	probably damaging	1.00
R6320:Smarca4	UTSW	9	21637375	missense	probably damaging	1.00
R6353:Smarca4	UTSW	9	21679149	critical splice donor site	probably null
R6461:Smarca4	UTSW	9	21679020	missense	probably damaging	1.00
R6886:Smarca4	UTSW	9	21658831	missense	probably damaging	1.00
R7098:Smarca4	UTSW	9	21634820	missense	probably benign	0.10
R7253:Smarca4	UTSW	9	21658960	missense	probably benign	0.01
R7307:Smarca4	UTSW	9	21638800	missense	probably damaging	1.00
R7382:Smarca4	UTSW	9	21658933	missense	probably damaging	0.98
R7445:Smarca4	UTSW	9	21686247	missense	probably damaging	1.00
R7535:Smarca4	UTSW	9	21647625	missense	possibly damaging	0.82
R7573:Smarca4	UTSW	9	21639075	splice site	probably null
R7644:Smarca4	UTSW	9	21655654	missense	probably benign	0.00
R7734:Smarca4	UTSW	9	21667362	missense	possibly damaging	0.65
R7833:Smarca4	UTSW	9	21647359	missense	possibly damaging	0.86
R8085:Smarca4	UTSW	9	21658812	splice site	probably null
R8119:Smarca4	UTSW	9	21647626	missense	possibly damaging	0.61
R8320:Smarca4	UTSW	9	21677502	missense	probably benign	0.10
R8445:Smarca4	UTSW	9	21700943	small deletion	probably benign
R8493:Smarca4	UTSW	9	21658848	missense	probably damaging	1.00
R8748:Smarca4	UTSW	9	21634868	missense	possibly damaging	0.85
R8788:Smarca4	UTSW	9	21638728	missense	probably damaging	1.00
R8817:Smarca4	UTSW	9	21636201	missense	probably benign	0.04
R9241:Smarca4	UTSW	9	21639308	missense	possibly damaging	0.72
R9446:Smarca4	UTSW	9	21635859	missense	unknown
R9570:Smarca4	UTSW	9	21669553	missense	probably damaging	1.00
R9727:Smarca4	UTSW	9	21699864	missense	probably damaging	1.00
R9801:Smarca4	UTSW	9	21675101	missense	probably damaging	1.00
Z1176:Smarca4	UTSW	9	21702957	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CTTCAGAGTGATGTGCTGCG -3'
(R):5'- AGCAGTATTTGGATGCAGCTC -3'

Sequencing Primer
(F):5'- TCTGATGCTGTAGCTCAGACCAG -3'
(R):5'- AGCTCTGCCTGCAAGTAGC -3'

Posted On

2017-03-31