Incidental Mutation 'R5964:Smarca4'
ID471954
Institutional Source Beutler Lab
Gene Symbol Smarca4
Ensembl Gene ENSMUSG00000032187
Gene NameSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4
SynonymsSNF2beta, SW1/SNF, b2b508.1Clo, Brg1, b2b692Clo
MMRRC Submission 044149-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5964 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location21616169-21704230 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 21647430 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 631 (T631K)
Ref Sequence ENSEMBL: ENSMUSP00000133922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034707] [ENSMUST00000098948] [ENSMUST00000174008]
Predicted Effect probably benign
Transcript: ENSMUST00000034707
AA Change: T631K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000034707
Gene: ENSMUSG00000032187
AA Change: T631K

DomainStartEndE-ValueType
low complexity region 6 58 N/A INTRINSIC
low complexity region 130 153 N/A INTRINSIC
QLQ 170 206 3.98e-14 SMART
low complexity region 221 247 N/A INTRINSIC
low complexity region 252 289 N/A INTRINSIC
low complexity region 304 330 N/A INTRINSIC
low complexity region 407 418 N/A INTRINSIC
HSA 460 532 2e-27 SMART
coiled coil region 563 595 N/A INTRINSIC
BRK 612 656 5.17e-21 SMART
low complexity region 657 672 N/A INTRINSIC
low complexity region 691 702 N/A INTRINSIC
DEXDc 750 942 5.17e-38 SMART
Blast:DEXDc 953 985 7e-10 BLAST
low complexity region 1019 1034 N/A INTRINSIC
HELICc 1110 1194 7.27e-24 SMART
low complexity region 1252 1267 N/A INTRINSIC
SnAC 1288 1356 2.8e-29 SMART
low complexity region 1360 1385 N/A INTRINSIC
low complexity region 1388 1398 N/A INTRINSIC
BROMO 1422 1533 4.19e-42 SMART
low complexity region 1534 1557 N/A INTRINSIC
low complexity region 1578 1588 N/A INTRINSIC
low complexity region 1594 1614 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098948
AA Change: T631K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000096547
Gene: ENSMUSG00000032187
AA Change: T631K

DomainStartEndE-ValueType
low complexity region 6 58 N/A INTRINSIC
low complexity region 130 153 N/A INTRINSIC
QLQ 170 206 3.98e-14 SMART
low complexity region 221 247 N/A INTRINSIC
low complexity region 252 289 N/A INTRINSIC
low complexity region 304 330 N/A INTRINSIC
low complexity region 407 418 N/A INTRINSIC
HSA 460 532 2e-27 SMART
coiled coil region 563 595 N/A INTRINSIC
BRK 612 656 5.17e-21 SMART
low complexity region 657 672 N/A INTRINSIC
low complexity region 691 702 N/A INTRINSIC
DEXDc 750 942 5.17e-38 SMART
Blast:DEXDc 953 985 7e-10 BLAST
low complexity region 1019 1034 N/A INTRINSIC
HELICc 1110 1194 7.27e-24 SMART
low complexity region 1252 1267 N/A INTRINSIC
SnAC 1288 1356 2.8e-29 SMART
low complexity region 1363 1388 N/A INTRINSIC
low complexity region 1391 1401 N/A INTRINSIC
BROMO 1425 1536 4.19e-42 SMART
low complexity region 1537 1560 N/A INTRINSIC
low complexity region 1581 1591 N/A INTRINSIC
low complexity region 1597 1617 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000172996
AA Change: T435K
SMART Domains Protein: ENSMUSP00000133535
Gene: ENSMUSG00000032187
AA Change: T435K

DomainStartEndE-ValueType
low complexity region 26 52 N/A INTRINSIC
low complexity region 57 94 N/A INTRINSIC
low complexity region 109 135 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
HSA 265 337 2e-27 SMART
coiled coil region 367 399 N/A INTRINSIC
BRK 417 461 5.17e-21 SMART
low complexity region 462 477 N/A INTRINSIC
low complexity region 496 507 N/A INTRINSIC
DEXDc 555 747 5.17e-38 SMART
Blast:DEXDc 758 790 6e-10 BLAST
low complexity region 824 839 N/A INTRINSIC
HELICc 915 999 7.27e-24 SMART
low complexity region 1088 1105 N/A INTRINSIC
SnAC 1126 1194 2.8e-29 SMART
low complexity region 1201 1226 N/A INTRINSIC
low complexity region 1229 1239 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174008
AA Change: T631K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000133922
Gene: ENSMUSG00000032187
AA Change: T631K

DomainStartEndE-ValueType
low complexity region 6 58 N/A INTRINSIC
low complexity region 130 153 N/A INTRINSIC
QLQ 170 206 3.98e-14 SMART
low complexity region 221 247 N/A INTRINSIC
low complexity region 252 289 N/A INTRINSIC
low complexity region 304 330 N/A INTRINSIC
low complexity region 407 418 N/A INTRINSIC
HSA 460 532 2e-27 SMART
coiled coil region 563 595 N/A INTRINSIC
BRK 612 656 5.17e-21 SMART
low complexity region 657 672 N/A INTRINSIC
low complexity region 691 702 N/A INTRINSIC
DEXDc 750 942 5.17e-38 SMART
Blast:DEXDc 953 985 7e-10 BLAST
low complexity region 1019 1034 N/A INTRINSIC
HELICc 1110 1194 7.27e-24 SMART
low complexity region 1252 1267 N/A INTRINSIC
SnAC 1288 1356 2.8e-29 SMART
low complexity region 1360 1385 N/A INTRINSIC
low complexity region 1388 1398 N/A INTRINSIC
BROMO 1422 1532 1.36e-41 SMART
low complexity region 1533 1556 N/A INTRINSIC
low complexity region 1577 1587 N/A INTRINSIC
low complexity region 1593 1613 N/A INTRINSIC
Meta Mutation Damage Score 0.0888 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.2%
Validation Efficiency 96% (87/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins and is similar to the brahma protein of Drosophila. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. In addition, this protein can bind BRCA1, as well as regulate the expression of the tumorigenic protein CD44. Mutations in this gene cause rhabdoid tumor predisposition syndrome type 2. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes for a null allele die in utero before implantation. Embryos heterozygous for this null allele and an ENU-induced allele show impaired definitive erythropoiesis, anemia and lethality during organogenesis. Heterozygotes for a different null allele show cyanosis and cardiovascular defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam15 G A 3: 89,343,567 Q581* probably null Het
Agl A G 3: 116,793,774 V44A probably damaging Het
Alpk3 T A 7: 81,092,260 D608E possibly damaging Het
Aspm C A 1: 139,455,227 probably benign Het
Bbs2 T C 8: 94,068,367 N692S probably benign Het
Bend4 A G 5: 67,417,818 I240T probably benign Het
Casp8 G T 1: 58,833,736 R277L possibly damaging Het
Ccdc61 A T 7: 18,900,940 I123N probably damaging Het
Ccr9 T G 9: 123,779,434 I60M probably benign Het
Cd163 T A 6: 124,326,572 W1066R probably benign Het
Cd226 A T 18: 89,207,183 H68L probably benign Het
Cdkn3 T A 14: 46,767,217 C79S probably null Het
Cnnm1 A T 19: 43,469,723 E658V probably benign Het
Cog7 T C 7: 121,956,029 R304G probably damaging Het
Cpt1a T A 19: 3,365,760 V286E possibly damaging Het
Creg2 C A 1: 39,624,954 R212L probably benign Het
Cyp26a1 T G 19: 37,699,962 S311A probably damaging Het
Cyp2b10 T C 7: 25,926,223 Y484H probably benign Het
Cyp3a44 T A 5: 145,788,467 Y308F possibly damaging Het
Dlg5 A G 14: 24,164,089 V744A probably benign Het
Dlgap2 T A 8: 14,727,128 Y124* probably null Het
Dnah3 T C 7: 119,922,880 D4030G probably benign Het
Dnah5 A G 15: 28,458,584 T4456A possibly damaging Het
Dtx2 T A 5: 136,023,699 V347D probably benign Het
Gigyf2 C T 1: 87,407,167 T294M probably damaging Het
Gli3 C G 13: 15,726,162 S1378* probably null Het
Gm884 A G 11: 103,542,120 S1232P possibly damaging Het
Gnao1 G A 8: 93,966,999 D337N probably benign Het
Gp2 T A 7: 119,449,129 Q422L probably benign Het
Ifit1 T A 19: 34,648,469 M335K possibly damaging Het
Ism1 T C 2: 139,678,757 S30P probably benign Het
Itgax A G 7: 128,140,447 D677G probably damaging Het
Kansl1l G A 1: 66,725,922 A442V probably damaging Het
Kif13a T C 13: 46,771,524 I311M probably damaging Het
Lsm14b T A 2: 180,031,425 S84R probably benign Het
Lzts3 A G 2: 130,636,288 Y297H probably damaging Het
Map4k3 A G 17: 80,644,762 I205T probably damaging Het
Matn2 A T 15: 34,410,165 N501I probably damaging Het
Mctp2 T C 7: 72,103,177 E776G probably damaging Het
Mex3d A T 10: 80,382,587 N265K probably damaging Het
Myo5a A G 9: 75,203,833 T1534A probably benign Het
Ncoa7 T C 10: 30,704,636 M35V probably damaging Het
Nek4 G A 14: 30,957,079 probably null Het
Ngrn T C 7: 80,261,933 probably null Het
Nlrp1a T A 11: 71,123,020 Q468L probably benign Het
Olfr1450 A C 19: 12,954,531 Q314P probably benign Het
Olfr743 T A 14: 50,534,198 M262K probably damaging Het
Phtf2 T C 5: 20,775,934 D433G probably damaging Het
Prdm13 G A 4: 21,683,852 Q140* probably null Het
Prtg G A 9: 72,892,254 G778E probably benign Het
Pum3 T C 19: 27,420,051 E308G probably damaging Het
Pwp1 T G 10: 85,882,886 F306V probably damaging Het
Rab24 A T 13: 55,321,576 Y27N probably damaging Het
Rnf215 T C 11: 4,135,898 F126L probably benign Het
Samd13 A T 3: 146,680,696 probably benign Het
Serac1 T A 17: 6,065,049 H213L probably benign Het
Slc45a3 A G 1: 131,978,073 E278G probably damaging Het
Slit3 C T 11: 35,700,236 R1292C probably damaging Het
Slx4 A T 16: 4,000,951 probably null Het
Snx16 C T 3: 10,434,481 R163Q possibly damaging Het
Stk40 T C 4: 126,128,895 V140A probably damaging Het
Tcf12 A T 9: 71,868,240 D409E probably damaging Het
Tgfbr2 G T 9: 116,110,255 T168K possibly damaging Het
Ticam1 G T 17: 56,271,703 H131N probably damaging Het
Ttn C A 2: 76,713,511 E31298* probably null Het
Ttn C A 2: 76,829,888 R7458I possibly damaging Het
Usp7 A G 16: 8,712,102 V133A possibly damaging Het
Wbp1l C T 19: 46,654,180 R191* probably null Het
Wdfy4 T C 14: 33,106,011 E1118G probably damaging Het
Zfp81 G C 17: 33,336,845 P3A probably damaging Het
Znhit6 A G 3: 145,576,933 K21R possibly damaging Het
Other mutations in Smarca4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Smarca4 APN 9 21679073 missense probably benign 0.30
IGL01694:Smarca4 APN 9 21665870 missense probably damaging 1.00
IGL02147:Smarca4 APN 9 21635703 missense probably damaging 0.98
IGL02417:Smarca4 APN 9 21701090 missense probably damaging 1.00
IGL02421:Smarca4 APN 9 21639239 missense probably damaging 1.00
IGL02550:Smarca4 APN 9 21686122 missense probably benign 0.25
IGL02794:Smarca4 APN 9 21673342 splice site probably benign
IGL03030:Smarca4 APN 9 21635836 missense probably benign 0.14
IGL03037:Smarca4 APN 9 21632935 unclassified probably benign
IGL03069:Smarca4 APN 9 21635836 missense probably benign 0.14
IGL03355:Smarca4 APN 9 21635836 missense probably benign 0.14
R0123:Smarca4 UTSW 9 21637324 missense probably damaging 1.00
R0134:Smarca4 UTSW 9 21637324 missense probably damaging 1.00
R0230:Smarca4 UTSW 9 21700872 missense probably damaging 0.99
R0269:Smarca4 UTSW 9 21636201 missense probably benign 0.09
R0631:Smarca4 UTSW 9 21658984 splice site probably benign
R0665:Smarca4 UTSW 9 21700943 small deletion probably benign
R0726:Smarca4 UTSW 9 21700139 critical splice donor site probably null
R0801:Smarca4 UTSW 9 21642554 missense possibly damaging 0.81
R0918:Smarca4 UTSW 9 21636215 missense probably benign 0.16
R1411:Smarca4 UTSW 9 21658955 missense probably damaging 1.00
R1604:Smarca4 UTSW 9 21700943 small deletion probably benign
R1768:Smarca4 UTSW 9 21701183 missense possibly damaging 0.56
R2004:Smarca4 UTSW 9 21677480 missense probably damaging 1.00
R2031:Smarca4 UTSW 9 21686062 missense possibly damaging 0.68
R2211:Smarca4 UTSW 9 21686029 missense probably damaging 1.00
R2512:Smarca4 UTSW 9 21635698 missense possibly damaging 0.95
R2875:Smarca4 UTSW 9 21642580 missense possibly damaging 0.55
R3786:Smarca4 UTSW 9 21672059 missense possibly damaging 0.94
R4829:Smarca4 UTSW 9 21639327 missense probably damaging 0.97
R5084:Smarca4 UTSW 9 21660763 missense probably damaging 1.00
R5222:Smarca4 UTSW 9 21655706 missense probably benign 0.01
R5785:Smarca4 UTSW 9 21686026 missense probably damaging 0.99
R5844:Smarca4 UTSW 9 21677942 intron probably benign
R6001:Smarca4 UTSW 9 21632909 unclassified probably benign
R6072:Smarca4 UTSW 9 21700121 missense probably damaging 1.00
R6254:Smarca4 UTSW 9 21699877 missense probably damaging 1.00
R6320:Smarca4 UTSW 9 21637375 missense probably damaging 1.00
R6353:Smarca4 UTSW 9 21679149 critical splice donor site probably null
R6461:Smarca4 UTSW 9 21679020 missense probably damaging 1.00
R6886:Smarca4 UTSW 9 21658831 missense probably damaging 1.00
R7098:Smarca4 UTSW 9 21634820 missense probably benign 0.10
R7253:Smarca4 UTSW 9 21658960 missense probably benign 0.01
R7307:Smarca4 UTSW 9 21638800 missense probably damaging 1.00
R7382:Smarca4 UTSW 9 21658933 missense probably damaging 0.98
R7445:Smarca4 UTSW 9 21686247 missense probably damaging 1.00
R7535:Smarca4 UTSW 9 21647625 missense possibly damaging 0.82
R7644:Smarca4 UTSW 9 21655654 missense probably benign 0.00
R7734:Smarca4 UTSW 9 21667362 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- CTTCAGAGTGATGTGCTGCG -3'
(R):5'- AGCAGTATTTGGATGCAGCTC -3'

Sequencing Primer
(F):5'- TCTGATGCTGTAGCTCAGACCAG -3'
(R):5'- AGCTCTGCCTGCAAGTAGC -3'
Posted On2017-03-31