Mutagenetix > Incidental Mutations

Incidental Mutation 'R5964:Tgfbr2'

471958

Institutional Source

Beutler Lab

Gene Symbol

Tgfbr2

Ensembl Gene

ENSMUSG00000032440

Gene Name

transforming growth factor, beta receptor II

Synonyms

TbetaR-II, TBR-II, TbetaRII, 1110020H15Rik

MMRRC Submission

044149-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5964 (G1)

Quality Score

155

Status

Validated

Chromosome

Chromosomal Location

116084293-116175360 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 116110255 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 168 (T168K)

Ref Sequence

ENSEMBL: ENSMUSP00000035014 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035014] [ENSMUST00000061101]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000035014
AA Change: T168K

PolyPhen 2 Score 0.640 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000035014
Gene: ENSMUSG00000032440
AA Change: T168K

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:ecTbetaR2	47	165	1.8e-55	PFAM
Pfam:Pkinase	244	538	9.9e-52	PFAM
Pfam:Pkinase_Tyr	244	538	2.9e-37	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000061101
AA Change: T193K

PolyPhen 2 Score 0.508 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000062333
Gene: ENSMUSG00000032440
AA Change: T193K

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:ecTbetaR2	74	184	4.6e-45	PFAM
transmembrane domain	189	211	N/A	INTRINSIC
Pfam:Pkinase	269	563	2.7e-36	PFAM
Pfam:Pkinase_Tyr	269	563	5e-37	PFAM

Meta Mutation Damage Score

0.2461

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.2%

Validation Efficiency

96% (87/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ser/Thr protein kinase family and the TGFB receptor subfamily. The encoded protein is a transmembrane protein that has a protein kinase domain, forms a heterodimeric complex with another receptor protein, and binds TGF-beta. This receptor/ligand complex phosphorylates proteins, which then enter the nucleus and regulate the transcription of a subset of genes related to cell proliferation. Mutations in this gene have been associated with Marfan Syndrome, Loeys-Deitz Aortic Aneurysm Syndrome, and the development of various types of tumors. Alternatively spliced transcript variants encoding different isoforms have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die in midgestation with impaired yolk sac hematopoiesis and vasculogenesis. Selective knockouts in bone marrow cells and cranial neural crest show inflammation and cleft palate/calvarial defects, respectively. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam15	G	A	3: 89,343,567	Q581*	probably null	Het
Agl	A	G	3: 116,793,774	V44A	probably damaging	Het
Alpk3	T	A	7: 81,092,260	D608E	possibly damaging	Het
Aspm	C	A	1: 139,455,227		probably benign	Het
Bbs2	T	C	8: 94,068,367	N692S	probably benign	Het
Bend4	A	G	5: 67,417,818	I240T	probably benign	Het
Casp8	G	T	1: 58,833,736	R277L	possibly damaging	Het
Ccdc61	A	T	7: 18,900,940	I123N	probably damaging	Het
Ccr9	T	G	9: 123,779,434	I60M	probably benign	Het
Cd163	T	A	6: 124,326,572	W1066R	probably benign	Het
Cd226	A	T	18: 89,207,183	H68L	probably benign	Het
Cdkn3	T	A	14: 46,767,217	C79S	probably null	Het
Cnnm1	A	T	19: 43,469,723	E658V	probably benign	Het
Cog7	T	C	7: 121,956,029	R304G	probably damaging	Het
Cpt1a	T	A	19: 3,365,760	V286E	possibly damaging	Het
Creg2	C	A	1: 39,624,954	R212L	probably benign	Het
Cyp26a1	T	G	19: 37,699,962	S311A	probably damaging	Het
Cyp2b10	T	C	7: 25,926,223	Y484H	probably benign	Het
Cyp3a44	T	A	5: 145,788,467	Y308F	possibly damaging	Het
Dlg5	A	G	14: 24,164,089	V744A	probably benign	Het
Dlgap2	T	A	8: 14,727,128	Y124*	probably null	Het
Dnah3	T	C	7: 119,922,880	D4030G	probably benign	Het
Dnah5	A	G	15: 28,458,584	T4456A	possibly damaging	Het
Dtx2	T	A	5: 136,023,699	V347D	probably benign	Het
Gigyf2	C	T	1: 87,407,167	T294M	probably damaging	Het
Gli3	C	G	13: 15,726,162	S1378*	probably null	Het
Gm884	A	G	11: 103,542,120	S1232P	possibly damaging	Het
Gnao1	G	A	8: 93,966,999	D337N	probably benign	Het
Gp2	T	A	7: 119,449,129	Q422L	probably benign	Het
Ifit1	T	A	19: 34,648,469	M335K	possibly damaging	Het
Ism1	T	C	2: 139,678,757	S30P	probably benign	Het
Itgax	A	G	7: 128,140,447	D677G	probably damaging	Het
Kansl1l	G	A	1: 66,725,922	A442V	probably damaging	Het
Kif13a	T	C	13: 46,771,524	I311M	probably damaging	Het
Lsm14b	T	A	2: 180,031,425	S84R	probably benign	Het
Lzts3	A	G	2: 130,636,288	Y297H	probably damaging	Het
Map4k3	A	G	17: 80,644,762	I205T	probably damaging	Het
Matn2	A	T	15: 34,410,165	N501I	probably damaging	Het
Mctp2	T	C	7: 72,103,177	E776G	probably damaging	Het
Mex3d	A	T	10: 80,382,587	N265K	probably damaging	Het
Myo5a	A	G	9: 75,203,833	T1534A	probably benign	Het
Ncoa7	T	C	10: 30,704,636	M35V	probably damaging	Het
Nek4	G	A	14: 30,957,079		probably null	Het
Ngrn	T	C	7: 80,261,933		probably null	Het
Nlrp1a	T	A	11: 71,123,020	Q468L	probably benign	Het
Olfr1450	A	C	19: 12,954,531	Q314P	probably benign	Het
Olfr743	T	A	14: 50,534,198	M262K	probably damaging	Het
Phtf2	T	C	5: 20,775,934	D433G	probably damaging	Het
Prdm13	G	A	4: 21,683,852	Q140*	probably null	Het
Prtg	G	A	9: 72,892,254	G778E	probably benign	Het
Pum3	T	C	19: 27,420,051	E308G	probably damaging	Het
Pwp1	T	G	10: 85,882,886	F306V	probably damaging	Het
Rab24	A	T	13: 55,321,576	Y27N	probably damaging	Het
Rnf215	T	C	11: 4,135,898	F126L	probably benign	Het
Samd13	A	T	3: 146,680,696		probably benign	Het
Serac1	T	A	17: 6,065,049	H213L	probably benign	Het
Slc45a3	A	G	1: 131,978,073	E278G	probably damaging	Het
Slit3	C	T	11: 35,700,236	R1292C	probably damaging	Het
Slx4	A	T	16: 4,000,951		probably null	Het
Smarca4	C	A	9: 21,647,430	T631K	probably benign	Het
Snx16	C	T	3: 10,434,481	R163Q	possibly damaging	Het
Stk40	T	C	4: 126,128,895	V140A	probably damaging	Het
Tcf12	A	T	9: 71,868,240	D409E	probably damaging	Het
Ticam1	G	T	17: 56,271,703	H131N	probably damaging	Het
Ttn	C	A	2: 76,713,511	E31298*	probably null	Het
Ttn	C	A	2: 76,829,888	R7458I	possibly damaging	Het
Usp7	A	G	16: 8,712,102	V133A	possibly damaging	Het
Wbp1l	C	T	19: 46,654,180	R191*	probably null	Het
Wdfy4	T	C	14: 33,106,011	E1118G	probably damaging	Het
Zfp81	G	C	17: 33,336,845	P3A	probably damaging	Het
Znhit6	A	G	3: 145,576,933	K21R	possibly damaging	Het

Other mutations in Tgfbr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Tgfbr2	APN	9	116110189	missense	probably damaging	0.99
IGL00484:Tgfbr2	APN	9	116158289	missense	probably benign	0.00
IGL01010:Tgfbr2	APN	9	116129980	missense	possibly damaging	0.80
IGL01656:Tgfbr2	APN	9	116109669	missense	probably damaging	1.00
IGL02496:Tgfbr2	APN	9	116090418	missense	probably benign	0.13
IGL02550:Tgfbr2	APN	9	116110129	missense	probably benign
IGL02563:Tgfbr2	APN	9	116129998	missense	probably benign	0.10
IGL03403:Tgfbr2	APN	9	116110302	missense	probably benign
IGL02799:Tgfbr2	UTSW	9	116110136	missense	possibly damaging	0.50
R0617:Tgfbr2	UTSW	9	116158320	missense	probably benign	0.00
R1483:Tgfbr2	UTSW	9	116109557	missense	probably benign	0.04
R1776:Tgfbr2	UTSW	9	116174967	missense	possibly damaging	0.94
R1777:Tgfbr2	UTSW	9	116109880	missense	probably damaging	0.99
R1831:Tgfbr2	UTSW	9	116090536	missense	possibly damaging	0.74
R2323:Tgfbr2	UTSW	9	116110144	missense	possibly damaging	0.90
R2378:Tgfbr2	UTSW	9	116129950	missense	probably benign	0.02
R3123:Tgfbr2	UTSW	9	116110069	missense	possibly damaging	0.95
R3418:Tgfbr2	UTSW	9	116129833	missense	probably damaging	1.00
R3605:Tgfbr2	UTSW	9	116109892	missense	probably benign	0.03
R4039:Tgfbr2	UTSW	9	116175037	start codon destroyed	probably null	0.62
R4191:Tgfbr2	UTSW	9	116109941	missense	probably damaging	1.00
R4193:Tgfbr2	UTSW	9	116109941	missense	probably damaging	1.00
R4945:Tgfbr2	UTSW	9	116131565	missense	probably benign
R5431:Tgfbr2	UTSW	9	116131601	missense	probably damaging	0.99
R5714:Tgfbr2	UTSW	9	116175024	missense	probably damaging	0.98
R6180:Tgfbr2	UTSW	9	116110144	missense	possibly damaging	0.90
R6970:Tgfbr2	UTSW	9	116110051	missense	probably damaging	0.97
R7228:Tgfbr2	UTSW	9	116109943	missense	probably damaging	1.00
R7258:Tgfbr2	UTSW	9	116129830	missense	probably damaging	0.98
R7315:Tgfbr2	UTSW	9	116109738	missense	possibly damaging	0.49
R8171:Tgfbr2	UTSW	9	116130006	nonsense	probably null
R8175:Tgfbr2	UTSW	9	116109955	missense	possibly damaging	0.92
R8417:Tgfbr2	UTSW	9	116110129	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TTCAGCTTGGCCTTGTAGACC -3'
(R):5'- CGGACCCAGTTTAGATGCTAC -3'

Sequencing Primer
(F):5'- CTTGTAGACCTCGGCGAAG -3'
(R):5'- ACCCAGTTTAGATGCTACCGTGC -3'

Posted On

2017-03-31