Incidental Mutation 'R5964:Ccr9'
ID 471959
Institutional Source Beutler Lab
Gene Symbol Ccr9
Ensembl Gene ENSMUSG00000029530
Gene Name C-C motif chemokine receptor 9
Synonyms GPR-9-6, Cmkbr10
MMRRC Submission 044149-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R5964 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 123596276-123612522 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 123608499 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 60 (I60M)
Ref Sequence ENSEMBL: ENSMUSP00000137144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111454] [ENSMUST00000163559] [ENSMUST00000166236] [ENSMUST00000168910] [ENSMUST00000180093]
AlphaFold Q9WUT7
Predicted Effect probably benign
Transcript: ENSMUST00000111454
AA Change: I48M

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000107081
Gene: ENSMUSG00000029530
AA Change: I48M

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 47 320 1.2e-5 PFAM
Pfam:7tm_1 53 305 1.1e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163559
AA Change: I60M

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000131782
Gene: ENSMUSG00000029530
AA Change: I60M

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 59 332 5.9e-6 PFAM
Pfam:7tm_1 65 317 3.4e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166236
AA Change: I60M

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000127024
Gene: ENSMUSG00000029530
AA Change: I60M

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 59 332 5.9e-6 PFAM
Pfam:7tm_1 65 317 4.6e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168910
AA Change: I60M

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000126758
Gene: ENSMUSG00000029530
AA Change: I60M

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 59 332 5.9e-6 PFAM
Pfam:7tm_1 65 317 3.4e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172093
Predicted Effect probably benign
Transcript: ENSMUST00000180093
AA Change: I60M

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000137144
Gene: ENSMUSG00000029530
AA Change: I60M

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 59 332 5.9e-6 PFAM
Pfam:7tm_1 65 317 3.4e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214413
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.2%
Validation Efficiency 96% (87/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the beta chemokine receptor family. It is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. Chemokines and their receptors are key regulators of the thymocytes migration and maturation in normal and inflammation conditions. The specific ligand of this receptor is CCL25. It has been found that this gene is differentially expressed by T lymphocytes of small intestine and colon, suggested a role in the thymocytes recruitment and development that may permit functional specialization of immune responses in different segment of the gastrointestinal tract. This gene is mapped to the chemokine receptor gene cluster region. Two alternatively spliced transcript variants have been described. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null mice have altered trafficing of lymphocytes to the intestine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam15 G A 3: 89,250,874 (GRCm39) Q581* probably null Het
Agl A G 3: 116,587,423 (GRCm39) V44A probably damaging Het
Alpk3 T A 7: 80,742,008 (GRCm39) D608E possibly damaging Het
Aspm C A 1: 139,382,965 (GRCm39) probably benign Het
Bbs2 T C 8: 94,794,995 (GRCm39) N692S probably benign Het
Bend4 A G 5: 67,575,161 (GRCm39) I240T probably benign Het
Casp8 G T 1: 58,872,895 (GRCm39) R277L possibly damaging Het
Ccdc61 A T 7: 18,634,865 (GRCm39) I123N probably damaging Het
Cd163 T A 6: 124,303,531 (GRCm39) W1066R probably benign Het
Cd226 A T 18: 89,225,307 (GRCm39) H68L probably benign Het
Cdkn3 T A 14: 47,004,674 (GRCm39) C79S probably null Het
Cnnm1 A T 19: 43,458,162 (GRCm39) E658V probably benign Het
Cog7 T C 7: 121,555,252 (GRCm39) R304G probably damaging Het
Cpt1a T A 19: 3,415,760 (GRCm39) V286E possibly damaging Het
Creg2 C A 1: 39,664,122 (GRCm39) R212L probably benign Het
Cyp26a1 T G 19: 37,688,410 (GRCm39) S311A probably damaging Het
Cyp2b10 T C 7: 25,625,648 (GRCm39) Y484H probably benign Het
Cyp3a44 T A 5: 145,725,277 (GRCm39) Y308F possibly damaging Het
Dlg5 A G 14: 24,214,157 (GRCm39) V744A probably benign Het
Dlgap2 T A 8: 14,777,128 (GRCm39) Y124* probably null Het
Dnah3 T C 7: 119,522,103 (GRCm39) D4030G probably benign Het
Dnah5 A G 15: 28,458,730 (GRCm39) T4456A possibly damaging Het
Dtx2 T A 5: 136,052,553 (GRCm39) V347D probably benign Het
Gigyf2 C T 1: 87,334,889 (GRCm39) T294M probably damaging Het
Gli3 C G 13: 15,900,747 (GRCm39) S1378* probably null Het
Gnao1 G A 8: 94,693,627 (GRCm39) D337N probably benign Het
Gp2 T A 7: 119,048,352 (GRCm39) Q422L probably benign Het
Ifit1 T A 19: 34,625,869 (GRCm39) M335K possibly damaging Het
Ism1 T C 2: 139,520,677 (GRCm39) S30P probably benign Het
Itgax A G 7: 127,739,619 (GRCm39) D677G probably damaging Het
Kansl1l G A 1: 66,765,081 (GRCm39) A442V probably damaging Het
Kif13a T C 13: 46,925,000 (GRCm39) I311M probably damaging Het
Lrrc37 A G 11: 103,432,946 (GRCm39) S1232P possibly damaging Het
Lsm14b T A 2: 179,673,218 (GRCm39) S84R probably benign Het
Lzts3 A G 2: 130,478,208 (GRCm39) Y297H probably damaging Het
Map4k3 A G 17: 80,952,191 (GRCm39) I205T probably damaging Het
Matn2 A T 15: 34,410,311 (GRCm39) N501I probably damaging Het
Mctp2 T C 7: 71,752,925 (GRCm39) E776G probably damaging Het
Mex3d A T 10: 80,218,421 (GRCm39) N265K probably damaging Het
Myo5a A G 9: 75,111,115 (GRCm39) T1534A probably benign Het
Ncoa7 T C 10: 30,580,632 (GRCm39) M35V probably damaging Het
Nek4 G A 14: 30,679,036 (GRCm39) probably null Het
Ngrn T C 7: 79,911,681 (GRCm39) probably null Het
Nlrp1a T A 11: 71,013,846 (GRCm39) Q468L probably benign Het
Or11g27 T A 14: 50,771,655 (GRCm39) M262K probably damaging Het
Or5b98 A C 19: 12,931,895 (GRCm39) Q314P probably benign Het
Phtf2 T C 5: 20,980,932 (GRCm39) D433G probably damaging Het
Prdm13 G A 4: 21,683,852 (GRCm39) Q140* probably null Het
Prtg G A 9: 72,799,536 (GRCm39) G778E probably benign Het
Pum3 T C 19: 27,397,451 (GRCm39) E308G probably damaging Het
Pwp1 T G 10: 85,718,750 (GRCm39) F306V probably damaging Het
Rab24 A T 13: 55,469,389 (GRCm39) Y27N probably damaging Het
Rnf215 T C 11: 4,085,898 (GRCm39) F126L probably benign Het
Samd13 A T 3: 146,386,451 (GRCm39) probably benign Het
Serac1 T A 17: 6,115,324 (GRCm39) H213L probably benign Het
Slc45a3 A G 1: 131,905,811 (GRCm39) E278G probably damaging Het
Slit3 C T 11: 35,591,063 (GRCm39) R1292C probably damaging Het
Slx4 A T 16: 3,818,815 (GRCm39) probably null Het
Smarca4 C A 9: 21,558,726 (GRCm39) T631K probably benign Het
Snx16 C T 3: 10,499,541 (GRCm39) R163Q possibly damaging Het
Stk40 T C 4: 126,022,688 (GRCm39) V140A probably damaging Het
Tcf12 A T 9: 71,775,522 (GRCm39) D409E probably damaging Het
Tgfbr2 G T 9: 115,939,323 (GRCm39) T168K possibly damaging Het
Ticam1 G T 17: 56,578,703 (GRCm39) H131N probably damaging Het
Ttn C A 2: 76,660,232 (GRCm39) R7458I possibly damaging Het
Ttn C A 2: 76,543,855 (GRCm39) E31298* probably null Het
Usp7 A G 16: 8,529,966 (GRCm39) V133A possibly damaging Het
Wbp1l C T 19: 46,642,619 (GRCm39) R191* probably null Het
Wdfy4 T C 14: 32,827,968 (GRCm39) E1118G probably damaging Het
Zfp81 G C 17: 33,555,819 (GRCm39) P3A probably damaging Het
Znhit6 A G 3: 145,282,688 (GRCm39) K21R possibly damaging Het
Other mutations in Ccr9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Ccr9 APN 9 123,609,109 (GRCm39) missense probably benign 0.00
IGL00983:Ccr9 APN 9 123,608,351 (GRCm39) missense probably benign
IGL02466:Ccr9 APN 9 123,608,911 (GRCm39) missense probably damaging 1.00
IGL03151:Ccr9 APN 9 123,603,638 (GRCm39) utr 5 prime probably benign
IGL03302:Ccr9 APN 9 123,608,601 (GRCm39) missense probably damaging 1.00
hamlet UTSW 9 123,608,504 (GRCm39) missense probably damaging 1.00
Laertes UTSW 9 123,608,911 (GRCm39) missense probably damaging 1.00
Ophelia UTSW 9 123,608,534 (GRCm39) missense probably damaging 1.00
R0310:Ccr9 UTSW 9 123,603,617 (GRCm39) utr 5 prime probably benign
R0393:Ccr9 UTSW 9 123,609,035 (GRCm39) missense probably benign 0.18
R0421:Ccr9 UTSW 9 123,608,671 (GRCm39) missense probably benign
R2069:Ccr9 UTSW 9 123,608,429 (GRCm39) missense probably benign 0.05
R3980:Ccr9 UTSW 9 123,608,441 (GRCm39) missense probably benign 0.14
R4645:Ccr9 UTSW 9 123,608,658 (GRCm39) missense probably benign 0.00
R4672:Ccr9 UTSW 9 123,608,752 (GRCm39) missense probably damaging 0.96
R4920:Ccr9 UTSW 9 123,608,504 (GRCm39) missense probably damaging 1.00
R5661:Ccr9 UTSW 9 123,609,164 (GRCm39) missense probably benign 0.04
R7037:Ccr9 UTSW 9 123,609,036 (GRCm39) missense possibly damaging 0.52
R7500:Ccr9 UTSW 9 123,608,534 (GRCm39) missense probably damaging 1.00
R7620:Ccr9 UTSW 9 123,608,911 (GRCm39) missense probably damaging 1.00
R7670:Ccr9 UTSW 9 123,608,371 (GRCm39) missense probably damaging 0.98
R7762:Ccr9 UTSW 9 123,609,022 (GRCm39) missense probably benign 0.08
R8154:Ccr9 UTSW 9 123,608,896 (GRCm39) missense probably benign 0.00
R8283:Ccr9 UTSW 9 123,608,696 (GRCm39) missense probably damaging 1.00
R8525:Ccr9 UTSW 9 123,608,732 (GRCm39) missense probably benign 0.31
R9046:Ccr9 UTSW 9 123,608,831 (GRCm39) missense probably benign
R9273:Ccr9 UTSW 9 123,609,085 (GRCm39) missense probably benign 0.07
R9462:Ccr9 UTSW 9 123,608,600 (GRCm39) missense probably damaging 1.00
X0026:Ccr9 UTSW 9 123,608,566 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGATCACTCAAAAGTTATCCTTGAC -3'
(R):5'- TGCTGTTCACAACCTTGCAC -3'

Sequencing Primer
(F):5'- AGTTATCCTTGACTGAATGCTATCC -3'
(R):5'- ACCTTGCACATGAAGGTCTG -3'
Posted On 2017-03-31