Incidental Mutation 'R5964:Pwp1'
ID471962
Institutional Source Beutler Lab
Gene Symbol Pwp1
Ensembl Gene ENSMUSG00000001785
Gene NamePWP1 homolog, endonuclein
Synonyms2610205J09Rik, 2310058A11Rik
MMRRC Submission 044149-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5964 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location85829494-85889096 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 85882886 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 306 (F306V)
Ref Sequence ENSEMBL: ENSMUSP00000001836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001836] [ENSMUST00000217667] [ENSMUST00000219256]
Predicted Effect probably damaging
Transcript: ENSMUST00000001836
AA Change: F306V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000001836
Gene: ENSMUSG00000001785
AA Change: F306V

DomainStartEndE-ValueType
low complexity region 45 61 N/A INTRINSIC
Blast:WD40 168 220 4e-27 BLAST
WD40 244 284 4.51e-7 SMART
WD40 287 327 3.37e-6 SMART
WD40 331 370 4.42e1 SMART
WD40 373 413 6.38e-7 SMART
Blast:WD40 418 458 3e-23 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164053
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164562
Predicted Effect probably benign
Transcript: ENSMUST00000217667
Predicted Effect probably benign
Transcript: ENSMUST00000219256
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219626
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219902
Meta Mutation Damage Score 0.8974 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.2%
Validation Efficiency 96% (87/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains several WD-40 repeats and is found mostly in the nucleus. The expression and localization of this protein are cell cycle dependent. Expression of this gene is upregulated in pancreatic adenocarcinoma. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam15 G A 3: 89,343,567 Q581* probably null Het
Agl A G 3: 116,793,774 V44A probably damaging Het
Alpk3 T A 7: 81,092,260 D608E possibly damaging Het
Aspm C A 1: 139,455,227 probably benign Het
Bbs2 T C 8: 94,068,367 N692S probably benign Het
Bend4 A G 5: 67,417,818 I240T probably benign Het
Casp8 G T 1: 58,833,736 R277L possibly damaging Het
Ccdc61 A T 7: 18,900,940 I123N probably damaging Het
Ccr9 T G 9: 123,779,434 I60M probably benign Het
Cd163 T A 6: 124,326,572 W1066R probably benign Het
Cd226 A T 18: 89,207,183 H68L probably benign Het
Cdkn3 T A 14: 46,767,217 C79S probably null Het
Cnnm1 A T 19: 43,469,723 E658V probably benign Het
Cog7 T C 7: 121,956,029 R304G probably damaging Het
Cpt1a T A 19: 3,365,760 V286E possibly damaging Het
Creg2 C A 1: 39,624,954 R212L probably benign Het
Cyp26a1 T G 19: 37,699,962 S311A probably damaging Het
Cyp2b10 T C 7: 25,926,223 Y484H probably benign Het
Cyp3a44 T A 5: 145,788,467 Y308F possibly damaging Het
Dlg5 A G 14: 24,164,089 V744A probably benign Het
Dlgap2 T A 8: 14,727,128 Y124* probably null Het
Dnah3 T C 7: 119,922,880 D4030G probably benign Het
Dnah5 A G 15: 28,458,584 T4456A possibly damaging Het
Dtx2 T A 5: 136,023,699 V347D probably benign Het
Gigyf2 C T 1: 87,407,167 T294M probably damaging Het
Gli3 C G 13: 15,726,162 S1378* probably null Het
Gm884 A G 11: 103,542,120 S1232P possibly damaging Het
Gnao1 G A 8: 93,966,999 D337N probably benign Het
Gp2 T A 7: 119,449,129 Q422L probably benign Het
Ifit1 T A 19: 34,648,469 M335K possibly damaging Het
Ism1 T C 2: 139,678,757 S30P probably benign Het
Itgax A G 7: 128,140,447 D677G probably damaging Het
Kansl1l G A 1: 66,725,922 A442V probably damaging Het
Kif13a T C 13: 46,771,524 I311M probably damaging Het
Lsm14b T A 2: 180,031,425 S84R probably benign Het
Lzts3 A G 2: 130,636,288 Y297H probably damaging Het
Map4k3 A G 17: 80,644,762 I205T probably damaging Het
Matn2 A T 15: 34,410,165 N501I probably damaging Het
Mctp2 T C 7: 72,103,177 E776G probably damaging Het
Mex3d A T 10: 80,382,587 N265K probably damaging Het
Myo5a A G 9: 75,203,833 T1534A probably benign Het
Ncoa7 T C 10: 30,704,636 M35V probably damaging Het
Nek4 G A 14: 30,957,079 probably null Het
Ngrn T C 7: 80,261,933 probably null Het
Nlrp1a T A 11: 71,123,020 Q468L probably benign Het
Olfr1450 A C 19: 12,954,531 Q314P probably benign Het
Olfr743 T A 14: 50,534,198 M262K probably damaging Het
Phtf2 T C 5: 20,775,934 D433G probably damaging Het
Prdm13 G A 4: 21,683,852 Q140* probably null Het
Prtg G A 9: 72,892,254 G778E probably benign Het
Pum3 T C 19: 27,420,051 E308G probably damaging Het
Rab24 A T 13: 55,321,576 Y27N probably damaging Het
Rnf215 T C 11: 4,135,898 F126L probably benign Het
Samd13 A T 3: 146,680,696 probably benign Het
Serac1 T A 17: 6,065,049 H213L probably benign Het
Slc45a3 A G 1: 131,978,073 E278G probably damaging Het
Slit3 C T 11: 35,700,236 R1292C probably damaging Het
Slx4 A T 16: 4,000,951 probably null Het
Smarca4 C A 9: 21,647,430 T631K probably benign Het
Snx16 C T 3: 10,434,481 R163Q possibly damaging Het
Stk40 T C 4: 126,128,895 V140A probably damaging Het
Tcf12 A T 9: 71,868,240 D409E probably damaging Het
Tgfbr2 G T 9: 116,110,255 T168K possibly damaging Het
Ticam1 G T 17: 56,271,703 H131N probably damaging Het
Ttn C A 2: 76,713,511 E31298* probably null Het
Ttn C A 2: 76,829,888 R7458I possibly damaging Het
Usp7 A G 16: 8,712,102 V133A possibly damaging Het
Wbp1l C T 19: 46,654,180 R191* probably null Het
Wdfy4 T C 14: 33,106,011 E1118G probably damaging Het
Zfp81 G C 17: 33,336,845 P3A probably damaging Het
Znhit6 A G 3: 145,576,933 K21R possibly damaging Het
Other mutations in Pwp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00707:Pwp1 APN 10 85878516 missense probably damaging 1.00
IGL00778:Pwp1 APN 10 85879888 missense probably benign 0.05
IGL01086:Pwp1 APN 10 85879893 unclassified probably null
IGL02526:Pwp1 APN 10 85882103 unclassified probably null
IGL02596:Pwp1 APN 10 85872018 unclassified probably null
IGL03164:Pwp1 APN 10 85878503 missense probably benign 0.19
IGL03269:Pwp1 APN 10 85882904 missense probably damaging 0.98
Annuals UTSW 10 85876514 missense probably damaging 1.00
R0031:Pwp1 UTSW 10 85885896 missense probably benign 0.20
R0049:Pwp1 UTSW 10 85885616 missense possibly damaging 0.67
R0049:Pwp1 UTSW 10 85885616 missense possibly damaging 0.67
R0766:Pwp1 UTSW 10 85879309 missense probably damaging 0.98
R0926:Pwp1 UTSW 10 85876514 missense probably damaging 1.00
R1238:Pwp1 UTSW 10 85885862 missense probably benign 0.02
R1312:Pwp1 UTSW 10 85879309 missense probably damaging 0.98
R1420:Pwp1 UTSW 10 85876538 missense probably damaging 1.00
R3177:Pwp1 UTSW 10 85882079 missense probably benign 0.45
R3277:Pwp1 UTSW 10 85882079 missense probably benign 0.45
R3818:Pwp1 UTSW 10 85888129 missense possibly damaging 0.76
R4008:Pwp1 UTSW 10 85882034 missense possibly damaging 0.60
R6252:Pwp1 UTSW 10 85874509 missense probably benign 0.00
R6280:Pwp1 UTSW 10 85874462 missense probably damaging 0.99
R6765:Pwp1 UTSW 10 85884533 missense probably damaging 0.99
R7168:Pwp1 UTSW 10 85884537 missense probably damaging 1.00
R7213:Pwp1 UTSW 10 85876309 missense probably benign
R7236:Pwp1 UTSW 10 85879283 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTACATTATTCTTAGAAGTGCTAGCC -3'
(R):5'- TCTTGTCTTAGTGCAGGCAGAG -3'

Sequencing Primer
(F):5'- ATTAGGCCAGCCAGCTCTATGTAG -3'
(R):5'- TCTTAGTGCAGGCAGAGCTCAAG -3'
Posted On2017-03-31