Mutagenetix > Incidental Mutation

Incidental Mutation 'R5964:Slit3'

471965

Institutional Source

Beutler Lab

Gene Symbol

Slit3

Ensembl Gene

ENSMUSG00000056427

Gene Name

slit guidance ligand 3

Synonyms

Slit1

MMRRC Submission

044149-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.878) question?

Stock #

R5964 (G1)

Quality Score

170

Status

Validated

Chromosome

Chromosomal Location

35121224-35708507 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 35700236 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 1292 (R1292C)

Ref Sequence

ENSEMBL: ENSMUSP00000066857 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069837]

AlphaFold

Q9WVB4

Predicted Effect

probably damaging
Transcript: ENSMUST00000069837
AA Change: R1292C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000066857
Gene: ENSMUSG00000056427
AA Change: R1292C

Domain	Start	End	E-Value	Type
low complexity region	2	23	N/A	INTRINSIC
LRRNT	33	65	2.12e-8	SMART
LRR	59	83	1.37e2	SMART
LRR_TYP	84	107	1.12e-3	SMART
LRR_TYP	108	131	7.78e-3	SMART
LRR_TYP	132	155	5.42e-2	SMART
LRR	156	179	5.88e0	SMART
LRR	180	203	7.55e-1	SMART
LRRCT	215	264	1.33e-6	SMART
LRRNT	279	311	6.79e-7	SMART
LRR	305	329	1.16e2	SMART
LRR	330	353	1.26e1	SMART
LRR_TYP	354	377	2.79e-4	SMART
LRR	378	401	4.05e-1	SMART
LRR	402	425	4.05e-1	SMART
LRRCT	437	486	7.75e-8	SMART
LRRNT	504	536	1.95e-7	SMART
LRR_TYP	556	579	7.49e-5	SMART
LRR	581	603	6.41e1	SMART
LRR_TYP	604	627	2.53e-2	SMART
LRR	628	651	1.76e-1	SMART
LRRCT	663	712	2.52e-7	SMART
LRRNT	724	756	3e-8	SMART
LRR	774	797	2.14e0	SMART
LRR_TYP	798	821	2.95e-3	SMART
LRR_TYP	822	845	2.43e-4	SMART
LRRCT	857	906	1.12e-13	SMART
EGF	919	953	6.86e-4	SMART
EGF	958	994	8.84e-7	SMART
EGF	999	1032	1.13e-4	SMART
EGF	1037	1072	2.3e-5	SMART
EGF_CA	1074	1110	5.92e-8	SMART
EGF	1122	1155	3.79e-6	SMART
LamG	1178	1314	3.16e-34	SMART
EGF	1331	1365	2.19e-2	SMART
EGF	1371	1403	1.13e-4	SMART
EGF	1411	1444	5.57e-4	SMART
CT	1455	1523	4.56e-5	SMART

Meta Mutation Damage Score

0.5689

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.2%

Validation Efficiency

96% (87/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is secreted, likely interacting with roundabout homolog receptors to effect cell migration. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a gene trap allele show congenital diaphragmatic hernia (CDH), variable renal defects and enlarged heart right ventricles. Mice homozygous for either of two reporter alleles show diaphragm dysgenesis and die prematurely; those with end-stage CDH show dyspnea and lung congestion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam15	G	A	3: 89,343,567	Q581*	probably null	Het
Agl	A	G	3: 116,793,774	V44A	probably damaging	Het
Alpk3	T	A	7: 81,092,260	D608E	possibly damaging	Het
Aspm	C	A	1: 139,455,227		probably benign	Het
Bbs2	T	C	8: 94,068,367	N692S	probably benign	Het
Bend4	A	G	5: 67,417,818	I240T	probably benign	Het
Casp8	G	T	1: 58,833,736	R277L	possibly damaging	Het
Ccdc61	A	T	7: 18,900,940	I123N	probably damaging	Het
Ccr9	T	G	9: 123,779,434	I60M	probably benign	Het
Cd163	T	A	6: 124,326,572	W1066R	probably benign	Het
Cd226	A	T	18: 89,207,183	H68L	probably benign	Het
Cdkn3	T	A	14: 46,767,217	C79S	probably null	Het
Cnnm1	A	T	19: 43,469,723	E658V	probably benign	Het
Cog7	T	C	7: 121,956,029	R304G	probably damaging	Het
Cpt1a	T	A	19: 3,365,760	V286E	possibly damaging	Het
Creg2	C	A	1: 39,624,954	R212L	probably benign	Het
Cyp26a1	T	G	19: 37,699,962	S311A	probably damaging	Het
Cyp2b10	T	C	7: 25,926,223	Y484H	probably benign	Het
Cyp3a44	T	A	5: 145,788,467	Y308F	possibly damaging	Het
Dlg5	A	G	14: 24,164,089	V744A	probably benign	Het
Dlgap2	T	A	8: 14,727,128	Y124*	probably null	Het
Dnah3	T	C	7: 119,922,880	D4030G	probably benign	Het
Dnah5	A	G	15: 28,458,584	T4456A	possibly damaging	Het
Dtx2	T	A	5: 136,023,699	V347D	probably benign	Het
Gigyf2	C	T	1: 87,407,167	T294M	probably damaging	Het
Gli3	C	G	13: 15,726,162	S1378*	probably null	Het
Gm884	A	G	11: 103,542,120	S1232P	possibly damaging	Het
Gnao1	G	A	8: 93,966,999	D337N	probably benign	Het
Gp2	T	A	7: 119,449,129	Q422L	probably benign	Het
Ifit1	T	A	19: 34,648,469	M335K	possibly damaging	Het
Ism1	T	C	2: 139,678,757	S30P	probably benign	Het
Itgax	A	G	7: 128,140,447	D677G	probably damaging	Het
Kansl1l	G	A	1: 66,725,922	A442V	probably damaging	Het
Kif13a	T	C	13: 46,771,524	I311M	probably damaging	Het
Lsm14b	T	A	2: 180,031,425	S84R	probably benign	Het
Lzts3	A	G	2: 130,636,288	Y297H	probably damaging	Het
Map4k3	A	G	17: 80,644,762	I205T	probably damaging	Het
Matn2	A	T	15: 34,410,165	N501I	probably damaging	Het
Mctp2	T	C	7: 72,103,177	E776G	probably damaging	Het
Mex3d	A	T	10: 80,382,587	N265K	probably damaging	Het
Myo5a	A	G	9: 75,203,833	T1534A	probably benign	Het
Ncoa7	T	C	10: 30,704,636	M35V	probably damaging	Het
Nek4	G	A	14: 30,957,079		probably null	Het
Ngrn	T	C	7: 80,261,933		probably null	Het
Nlrp1a	T	A	11: 71,123,020	Q468L	probably benign	Het
Olfr1450	A	C	19: 12,954,531	Q314P	probably benign	Het
Olfr743	T	A	14: 50,534,198	M262K	probably damaging	Het
Phtf2	T	C	5: 20,775,934	D433G	probably damaging	Het
Prdm13	G	A	4: 21,683,852	Q140*	probably null	Het
Prtg	G	A	9: 72,892,254	G778E	probably benign	Het
Pum3	T	C	19: 27,420,051	E308G	probably damaging	Het
Pwp1	T	G	10: 85,882,886	F306V	probably damaging	Het
Rab24	A	T	13: 55,321,576	Y27N	probably damaging	Het
Rnf215	T	C	11: 4,135,898	F126L	probably benign	Het
Samd13	A	T	3: 146,680,696		probably benign	Het
Serac1	T	A	17: 6,065,049	H213L	probably benign	Het
Slc45a3	A	G	1: 131,978,073	E278G	probably damaging	Het
Slx4	A	T	16: 4,000,951		probably null	Het
Smarca4	C	A	9: 21,647,430	T631K	probably benign	Het
Snx16	C	T	3: 10,434,481	R163Q	possibly damaging	Het
Stk40	T	C	4: 126,128,895	V140A	probably damaging	Het
Tcf12	A	T	9: 71,868,240	D409E	probably damaging	Het
Tgfbr2	G	T	9: 116,110,255	T168K	possibly damaging	Het
Ticam1	G	T	17: 56,271,703	H131N	probably damaging	Het
Ttn	C	A	2: 76,713,511	E31298*	probably null	Het
Ttn	C	A	2: 76,829,888	R7458I	possibly damaging	Het
Usp7	A	G	16: 8,712,102	V133A	possibly damaging	Het
Wbp1l	C	T	19: 46,654,180	R191*	probably null	Het
Wdfy4	T	C	14: 33,106,011	E1118G	probably damaging	Het
Zfp81	G	C	17: 33,336,845	P3A	probably damaging	Het
Znhit6	A	G	3: 145,576,933	K21R	possibly damaging	Het

Other mutations in Slit3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00731:Slit3	APN	11	35622154	missense	probably damaging	1.00
IGL01324:Slit3	APN	11	35610702	missense	probably damaging	1.00
IGL01612:Slit3	APN	11	35700384	missense	possibly damaging	0.95
IGL02145:Slit3	APN	11	35629742	missense	probably damaging	0.99
IGL02146:Slit3	APN	11	35234848	missense	possibly damaging	0.71
IGL02430:Slit3	APN	11	35177774	splice site	probably null
IGL02528:Slit3	APN	11	35578974	missense	probably benign
IGL02530:Slit3	APN	11	35708142	makesense	probably null
IGL02640:Slit3	APN	11	35700345	missense	probably benign	0.10
IGL02819:Slit3	APN	11	35171590	missense	possibly damaging	0.71
IGL02839:Slit3	APN	11	35649047	missense	possibly damaging	0.46
IGL03150:Slit3	APN	11	35508257	missense	possibly damaging	0.88
IGL03161:Slit3	APN	11	35700414	missense	probably benign	0.10
IGL03336:Slit3	APN	11	35670101	missense	probably damaging	0.97
Bloated	UTSW	11	35633952	missense	possibly damaging	0.55
Quellung	UTSW	11	35651820	critical splice donor site	probably null
IGL02988:Slit3	UTSW	11	35708063	missense	probably damaging	0.99
PIT4791001:Slit3	UTSW	11	35661245	missense	possibly damaging	0.85
R0013:Slit3	UTSW	11	35707918	missense	probably benign
R0013:Slit3	UTSW	11	35707918	missense	probably benign
R0334:Slit3	UTSW	11	35579101	missense	probably damaging	0.97
R0385:Slit3	UTSW	11	35700282	missense	probably damaging	0.98
R0840:Slit3	UTSW	11	35623436	splice site	probably benign
R1065:Slit3	UTSW	11	35121635	missense	possibly damaging	0.86
R1364:Slit3	UTSW	11	35670107	missense	probably benign
R1476:Slit3	UTSW	11	35686299	missense	probably damaging	0.97
R1508:Slit3	UTSW	11	35570621	missense	probably damaging	1.00
R1665:Slit3	UTSW	11	35234906	missense	possibly damaging	0.71
R1692:Slit3	UTSW	11	35659344	missense	probably damaging	1.00
R1696:Slit3	UTSW	11	35675923	missense	probably damaging	0.99
R1727:Slit3	UTSW	11	35629832	missense	probably damaging	1.00
R1752:Slit3	UTSW	11	35564653	missense	probably damaging	0.98
R1970:Slit3	UTSW	11	35630841	critical splice acceptor site	probably null
R2077:Slit3	UTSW	11	35544748	missense	possibly damaging	0.88
R2126:Slit3	UTSW	11	35688679	missense	probably damaging	1.00
R2143:Slit3	UTSW	11	35612261	splice site	probably null
R2162:Slit3	UTSW	11	35688682	missense	probably null	1.00
R2873:Slit3	UTSW	11	35544793	nonsense	probably null
R3813:Slit3	UTSW	11	35675979	missense	probably damaging	1.00
R3831:Slit3	UTSW	11	35688682	missense	probably null	1.00
R3832:Slit3	UTSW	11	35688682	missense	probably null	1.00
R3833:Slit3	UTSW	11	35688682	missense	probably null	1.00
R3839:Slit3	UTSW	11	35508237	missense	probably benign	0.10
R4152:Slit3	UTSW	11	35698320	missense	probably damaging	0.98
R4387:Slit3	UTSW	11	35684048	missense	probably benign	0.12
R4795:Slit3	UTSW	11	35651820	critical splice donor site	probably null
R4910:Slit3	UTSW	11	35632722	missense	probably damaging	0.99
R4933:Slit3	UTSW	11	35688593	missense	probably damaging	1.00
R5048:Slit3	UTSW	11	35588985	missense	probably damaging	1.00
R5106:Slit3	UTSW	11	35612367	missense	probably damaging	1.00
R5138:Slit3	UTSW	11	35588985	missense	probably damaging	1.00
R5218:Slit3	UTSW	11	35684175	critical splice donor site	probably null
R5338:Slit3	UTSW	11	35622148	missense	probably benign
R5354:Slit3	UTSW	11	35675913	missense	probably damaging	1.00
R5436:Slit3	UTSW	11	35707911	missense	probably benign	0.05
R5896:Slit3	UTSW	11	35708105	missense	probably damaging	0.99
R5933:Slit3	UTSW	11	35629751	missense	probably benign	0.04
R5963:Slit3	UTSW	11	35700236	missense	probably damaging	1.00
R6125:Slit3	UTSW	11	35570733	critical splice donor site	probably null
R6153:Slit3	UTSW	11	35700483	missense	possibly damaging	0.69
R6484:Slit3	UTSW	11	35661298	missense	probably benign
R6526:Slit3	UTSW	11	35661292	missense	probably benign	0.33
R6797:Slit3	UTSW	11	35633952	missense	possibly damaging	0.55
R6887:Slit3	UTSW	11	35544806	splice site	probably null
R7067:Slit3	UTSW	11	35508230	missense	probably benign	0.04
R7150:Slit3	UTSW	11	35570719	missense	probably damaging	1.00
R7228:Slit3	UTSW	11	35599418	missense	probably damaging	1.00
R7232:Slit3	UTSW	11	35610689	missense	possibly damaging	0.87
R7418:Slit3	UTSW	11	35686428	missense	possibly damaging	0.64
R7545:Slit3	UTSW	11	35700312	missense	possibly damaging	0.52
R7727:Slit3	UTSW	11	35684044	missense	probably damaging	1.00
R7820:Slit3	UTSW	11	35700408	missense	probably benign	0.23
R8177:Slit3	UTSW	11	35579092	missense	probably damaging	0.99
R8179:Slit3	UTSW	11	35664076	missense	probably benign	0.31
R8416:Slit3	UTSW	11	35508235	missense	probably benign	0.08
R8417:Slit3	UTSW	11	35610611	missense	probably damaging	0.99
R8476:Slit3	UTSW	11	35629769	missense	possibly damaging	0.70
R8785:Slit3	UTSW	11	35670141	missense	probably damaging	0.98
R8955:Slit3	UTSW	11	35698380	missense	probably damaging	0.97
R9040:Slit3	UTSW	11	35703309	missense	probably damaging	0.98
R9068:Slit3	UTSW	11	35684090	missense	probably damaging	1.00
R9088:Slit3	UTSW	11	35121636	missense	possibly damaging	0.86
R9266:Slit3	UTSW	11	35707981	missense	probably damaging	0.98
R9539:Slit3	UTSW	11	35698328	nonsense	probably null
X0028:Slit3	UTSW	11	35564637	missense	probably damaging	0.99
Z1176:Slit3	UTSW	11	35707924	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGGATAAGGCCAGGGCTTTG -3'
(R):5'- CCGAGCTTCCTGATCACATAGC -3'

Sequencing Primer
(F):5'- TTGGCCTGCTAACCCTGAG -3'
(R):5'- TTCCTGATCACATAGCGGACCG -3'

Posted On

2017-03-31