Incidental Mutation 'R5964:Slit3'
ID 471965
Institutional Source Beutler Lab
Gene Symbol Slit3
Ensembl Gene ENSMUSG00000056427
Gene Name slit guidance ligand 3
Synonyms Slit1, b2b2362.1Clo
MMRRC Submission 044149-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.897) question?
Stock # R5964 (G1)
Quality Score 170
Status Validated
Chromosome 11
Chromosomal Location 35012283-35599334 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 35591063 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 1292 (R1292C)
Ref Sequence ENSEMBL: ENSMUSP00000066857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069837]
AlphaFold Q9WVB4
Predicted Effect probably damaging
Transcript: ENSMUST00000069837
AA Change: R1292C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066857
Gene: ENSMUSG00000056427
AA Change: R1292C

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
LRRNT 33 65 2.12e-8 SMART
LRR 59 83 1.37e2 SMART
LRR_TYP 84 107 1.12e-3 SMART
LRR_TYP 108 131 7.78e-3 SMART
LRR_TYP 132 155 5.42e-2 SMART
LRR 156 179 5.88e0 SMART
LRR 180 203 7.55e-1 SMART
LRRCT 215 264 1.33e-6 SMART
LRRNT 279 311 6.79e-7 SMART
LRR 305 329 1.16e2 SMART
LRR 330 353 1.26e1 SMART
LRR_TYP 354 377 2.79e-4 SMART
LRR 378 401 4.05e-1 SMART
LRR 402 425 4.05e-1 SMART
LRRCT 437 486 7.75e-8 SMART
LRRNT 504 536 1.95e-7 SMART
LRR_TYP 556 579 7.49e-5 SMART
LRR 581 603 6.41e1 SMART
LRR_TYP 604 627 2.53e-2 SMART
LRR 628 651 1.76e-1 SMART
LRRCT 663 712 2.52e-7 SMART
LRRNT 724 756 3e-8 SMART
LRR 774 797 2.14e0 SMART
LRR_TYP 798 821 2.95e-3 SMART
LRR_TYP 822 845 2.43e-4 SMART
LRRCT 857 906 1.12e-13 SMART
EGF 919 953 6.86e-4 SMART
EGF 958 994 8.84e-7 SMART
EGF 999 1032 1.13e-4 SMART
EGF 1037 1072 2.3e-5 SMART
EGF_CA 1074 1110 5.92e-8 SMART
EGF 1122 1155 3.79e-6 SMART
LamG 1178 1314 3.16e-34 SMART
EGF 1331 1365 2.19e-2 SMART
EGF 1371 1403 1.13e-4 SMART
EGF 1411 1444 5.57e-4 SMART
CT 1455 1523 4.56e-5 SMART
Meta Mutation Damage Score 0.5689 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.2%
Validation Efficiency 96% (87/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is secreted, likely interacting with roundabout homolog receptors to effect cell migration. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a gene trap allele show congenital diaphragmatic hernia (CDH), variable renal defects and enlarged heart right ventricles. Mice homozygous for either of two reporter alleles show diaphragm dysgenesis and die prematurely; those with end-stage CDH show dyspnea and lung congestion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam15 G A 3: 89,250,874 (GRCm39) Q581* probably null Het
Agl A G 3: 116,587,423 (GRCm39) V44A probably damaging Het
Alpk3 T A 7: 80,742,008 (GRCm39) D608E possibly damaging Het
Aspm C A 1: 139,382,965 (GRCm39) probably benign Het
Bbs2 T C 8: 94,794,995 (GRCm39) N692S probably benign Het
Bend4 A G 5: 67,575,161 (GRCm39) I240T probably benign Het
Casp8 G T 1: 58,872,895 (GRCm39) R277L possibly damaging Het
Ccdc61 A T 7: 18,634,865 (GRCm39) I123N probably damaging Het
Ccr9 T G 9: 123,608,499 (GRCm39) I60M probably benign Het
Cd163 T A 6: 124,303,531 (GRCm39) W1066R probably benign Het
Cd226 A T 18: 89,225,307 (GRCm39) H68L probably benign Het
Cdkn3 T A 14: 47,004,674 (GRCm39) C79S probably null Het
Cnnm1 A T 19: 43,458,162 (GRCm39) E658V probably benign Het
Cog7 T C 7: 121,555,252 (GRCm39) R304G probably damaging Het
Cpt1a T A 19: 3,415,760 (GRCm39) V286E possibly damaging Het
Creg2 C A 1: 39,664,122 (GRCm39) R212L probably benign Het
Cyp26a1 T G 19: 37,688,410 (GRCm39) S311A probably damaging Het
Cyp2b10 T C 7: 25,625,648 (GRCm39) Y484H probably benign Het
Cyp3a44 T A 5: 145,725,277 (GRCm39) Y308F possibly damaging Het
Dlg5 A G 14: 24,214,157 (GRCm39) V744A probably benign Het
Dlgap2 T A 8: 14,777,128 (GRCm39) Y124* probably null Het
Dnah3 T C 7: 119,522,103 (GRCm39) D4030G probably benign Het
Dnah5 A G 15: 28,458,730 (GRCm39) T4456A possibly damaging Het
Dtx2 T A 5: 136,052,553 (GRCm39) V347D probably benign Het
Gigyf2 C T 1: 87,334,889 (GRCm39) T294M probably damaging Het
Gli3 C G 13: 15,900,747 (GRCm39) S1378* probably null Het
Gnao1 G A 8: 94,693,627 (GRCm39) D337N probably benign Het
Gp2 T A 7: 119,048,352 (GRCm39) Q422L probably benign Het
Ifit1 T A 19: 34,625,869 (GRCm39) M335K possibly damaging Het
Ism1 T C 2: 139,520,677 (GRCm39) S30P probably benign Het
Itgax A G 7: 127,739,619 (GRCm39) D677G probably damaging Het
Kansl1l G A 1: 66,765,081 (GRCm39) A442V probably damaging Het
Kif13a T C 13: 46,925,000 (GRCm39) I311M probably damaging Het
Lrrc37 A G 11: 103,432,946 (GRCm39) S1232P possibly damaging Het
Lsm14b T A 2: 179,673,218 (GRCm39) S84R probably benign Het
Lzts3 A G 2: 130,478,208 (GRCm39) Y297H probably damaging Het
Map4k3 A G 17: 80,952,191 (GRCm39) I205T probably damaging Het
Matn2 A T 15: 34,410,311 (GRCm39) N501I probably damaging Het
Mctp2 T C 7: 71,752,925 (GRCm39) E776G probably damaging Het
Mex3d A T 10: 80,218,421 (GRCm39) N265K probably damaging Het
Myo5a A G 9: 75,111,115 (GRCm39) T1534A probably benign Het
Ncoa7 T C 10: 30,580,632 (GRCm39) M35V probably damaging Het
Nek4 G A 14: 30,679,036 (GRCm39) probably null Het
Ngrn T C 7: 79,911,681 (GRCm39) probably null Het
Nlrp1a T A 11: 71,013,846 (GRCm39) Q468L probably benign Het
Or11g27 T A 14: 50,771,655 (GRCm39) M262K probably damaging Het
Or5b98 A C 19: 12,931,895 (GRCm39) Q314P probably benign Het
Phtf2 T C 5: 20,980,932 (GRCm39) D433G probably damaging Het
Prdm13 G A 4: 21,683,852 (GRCm39) Q140* probably null Het
Prtg G A 9: 72,799,536 (GRCm39) G778E probably benign Het
Pum3 T C 19: 27,397,451 (GRCm39) E308G probably damaging Het
Pwp1 T G 10: 85,718,750 (GRCm39) F306V probably damaging Het
Rab24 A T 13: 55,469,389 (GRCm39) Y27N probably damaging Het
Rnf215 T C 11: 4,085,898 (GRCm39) F126L probably benign Het
Samd13 A T 3: 146,386,451 (GRCm39) probably benign Het
Serac1 T A 17: 6,115,324 (GRCm39) H213L probably benign Het
Slc45a3 A G 1: 131,905,811 (GRCm39) E278G probably damaging Het
Slx4 A T 16: 3,818,815 (GRCm39) probably null Het
Smarca4 C A 9: 21,558,726 (GRCm39) T631K probably benign Het
Snx16 C T 3: 10,499,541 (GRCm39) R163Q possibly damaging Het
Stk40 T C 4: 126,022,688 (GRCm39) V140A probably damaging Het
Tcf12 A T 9: 71,775,522 (GRCm39) D409E probably damaging Het
Tgfbr2 G T 9: 115,939,323 (GRCm39) T168K possibly damaging Het
Ticam1 G T 17: 56,578,703 (GRCm39) H131N probably damaging Het
Ttn C A 2: 76,543,855 (GRCm39) E31298* probably null Het
Ttn C A 2: 76,660,232 (GRCm39) R7458I possibly damaging Het
Usp7 A G 16: 8,529,966 (GRCm39) V133A possibly damaging Het
Wbp1l C T 19: 46,642,619 (GRCm39) R191* probably null Het
Wdfy4 T C 14: 32,827,968 (GRCm39) E1118G probably damaging Het
Zfp81 G C 17: 33,555,819 (GRCm39) P3A probably damaging Het
Znhit6 A G 3: 145,282,688 (GRCm39) K21R possibly damaging Het
Other mutations in Slit3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00731:Slit3 APN 11 35,512,981 (GRCm39) missense probably damaging 1.00
IGL01324:Slit3 APN 11 35,501,529 (GRCm39) missense probably damaging 1.00
IGL01612:Slit3 APN 11 35,591,211 (GRCm39) missense possibly damaging 0.95
IGL02145:Slit3 APN 11 35,520,569 (GRCm39) missense probably damaging 0.99
IGL02146:Slit3 APN 11 35,125,675 (GRCm39) missense possibly damaging 0.71
IGL02430:Slit3 APN 11 35,068,601 (GRCm39) splice site probably null
IGL02528:Slit3 APN 11 35,469,801 (GRCm39) missense probably benign
IGL02530:Slit3 APN 11 35,598,969 (GRCm39) makesense probably null
IGL02640:Slit3 APN 11 35,591,172 (GRCm39) missense probably benign 0.10
IGL02819:Slit3 APN 11 35,062,417 (GRCm39) missense possibly damaging 0.71
IGL02839:Slit3 APN 11 35,539,874 (GRCm39) missense possibly damaging 0.46
IGL03150:Slit3 APN 11 35,399,084 (GRCm39) missense possibly damaging 0.88
IGL03161:Slit3 APN 11 35,591,241 (GRCm39) missense probably benign 0.10
IGL03336:Slit3 APN 11 35,560,928 (GRCm39) missense probably damaging 0.97
Bloated UTSW 11 35,524,779 (GRCm39) missense possibly damaging 0.55
Quellung UTSW 11 35,542,647 (GRCm39) critical splice donor site probably null
IGL02988:Slit3 UTSW 11 35,598,890 (GRCm39) missense probably damaging 0.99
PIT4791001:Slit3 UTSW 11 35,552,072 (GRCm39) missense possibly damaging 0.85
R0013:Slit3 UTSW 11 35,598,745 (GRCm39) missense probably benign
R0013:Slit3 UTSW 11 35,598,745 (GRCm39) missense probably benign
R0334:Slit3 UTSW 11 35,469,928 (GRCm39) missense probably damaging 0.97
R0385:Slit3 UTSW 11 35,591,109 (GRCm39) missense probably damaging 0.98
R0840:Slit3 UTSW 11 35,514,263 (GRCm39) splice site probably benign
R1065:Slit3 UTSW 11 35,012,462 (GRCm39) missense possibly damaging 0.86
R1364:Slit3 UTSW 11 35,560,934 (GRCm39) missense probably benign
R1476:Slit3 UTSW 11 35,577,126 (GRCm39) missense probably damaging 0.97
R1508:Slit3 UTSW 11 35,461,448 (GRCm39) missense probably damaging 1.00
R1665:Slit3 UTSW 11 35,125,733 (GRCm39) missense possibly damaging 0.71
R1692:Slit3 UTSW 11 35,550,171 (GRCm39) missense probably damaging 1.00
R1696:Slit3 UTSW 11 35,566,750 (GRCm39) missense probably damaging 0.99
R1727:Slit3 UTSW 11 35,520,659 (GRCm39) missense probably damaging 1.00
R1752:Slit3 UTSW 11 35,455,480 (GRCm39) missense probably damaging 0.98
R1970:Slit3 UTSW 11 35,521,668 (GRCm39) critical splice acceptor site probably null
R2077:Slit3 UTSW 11 35,435,575 (GRCm39) missense possibly damaging 0.88
R2126:Slit3 UTSW 11 35,579,506 (GRCm39) missense probably damaging 1.00
R2143:Slit3 UTSW 11 35,503,088 (GRCm39) splice site probably null
R2162:Slit3 UTSW 11 35,579,509 (GRCm39) missense probably null 1.00
R2873:Slit3 UTSW 11 35,435,620 (GRCm39) nonsense probably null
R3813:Slit3 UTSW 11 35,566,806 (GRCm39) missense probably damaging 1.00
R3831:Slit3 UTSW 11 35,579,509 (GRCm39) missense probably null 1.00
R3832:Slit3 UTSW 11 35,579,509 (GRCm39) missense probably null 1.00
R3833:Slit3 UTSW 11 35,579,509 (GRCm39) missense probably null 1.00
R3839:Slit3 UTSW 11 35,399,064 (GRCm39) missense probably benign 0.10
R4152:Slit3 UTSW 11 35,589,147 (GRCm39) missense probably damaging 0.98
R4387:Slit3 UTSW 11 35,574,875 (GRCm39) missense probably benign 0.12
R4795:Slit3 UTSW 11 35,542,647 (GRCm39) critical splice donor site probably null
R4910:Slit3 UTSW 11 35,523,549 (GRCm39) missense probably damaging 0.99
R4933:Slit3 UTSW 11 35,579,420 (GRCm39) missense probably damaging 1.00
R5048:Slit3 UTSW 11 35,479,812 (GRCm39) missense probably damaging 1.00
R5106:Slit3 UTSW 11 35,503,194 (GRCm39) missense probably damaging 1.00
R5138:Slit3 UTSW 11 35,479,812 (GRCm39) missense probably damaging 1.00
R5218:Slit3 UTSW 11 35,575,002 (GRCm39) critical splice donor site probably null
R5338:Slit3 UTSW 11 35,512,975 (GRCm39) missense probably benign
R5354:Slit3 UTSW 11 35,566,740 (GRCm39) missense probably damaging 1.00
R5436:Slit3 UTSW 11 35,598,738 (GRCm39) missense probably benign 0.05
R5896:Slit3 UTSW 11 35,598,932 (GRCm39) missense probably damaging 0.99
R5933:Slit3 UTSW 11 35,520,578 (GRCm39) missense probably benign 0.04
R5963:Slit3 UTSW 11 35,591,063 (GRCm39) missense probably damaging 1.00
R6125:Slit3 UTSW 11 35,461,560 (GRCm39) critical splice donor site probably null
R6153:Slit3 UTSW 11 35,591,310 (GRCm39) missense possibly damaging 0.69
R6484:Slit3 UTSW 11 35,552,125 (GRCm39) missense probably benign
R6526:Slit3 UTSW 11 35,552,119 (GRCm39) missense probably benign 0.33
R6797:Slit3 UTSW 11 35,524,779 (GRCm39) missense possibly damaging 0.55
R6887:Slit3 UTSW 11 35,435,633 (GRCm39) splice site probably null
R7067:Slit3 UTSW 11 35,399,057 (GRCm39) missense probably benign 0.04
R7150:Slit3 UTSW 11 35,461,546 (GRCm39) missense probably damaging 1.00
R7228:Slit3 UTSW 11 35,490,245 (GRCm39) missense probably damaging 1.00
R7232:Slit3 UTSW 11 35,501,516 (GRCm39) missense possibly damaging 0.87
R7418:Slit3 UTSW 11 35,577,255 (GRCm39) missense possibly damaging 0.64
R7545:Slit3 UTSW 11 35,591,139 (GRCm39) missense possibly damaging 0.52
R7727:Slit3 UTSW 11 35,574,871 (GRCm39) missense probably damaging 1.00
R7820:Slit3 UTSW 11 35,591,235 (GRCm39) missense probably benign 0.23
R8177:Slit3 UTSW 11 35,469,919 (GRCm39) missense probably damaging 0.99
R8179:Slit3 UTSW 11 35,554,903 (GRCm39) missense probably benign 0.31
R8416:Slit3 UTSW 11 35,399,062 (GRCm39) missense probably benign 0.08
R8417:Slit3 UTSW 11 35,501,438 (GRCm39) missense probably damaging 0.99
R8476:Slit3 UTSW 11 35,520,596 (GRCm39) missense possibly damaging 0.70
R8785:Slit3 UTSW 11 35,560,968 (GRCm39) missense probably damaging 0.98
R8955:Slit3 UTSW 11 35,589,207 (GRCm39) missense probably damaging 0.97
R9040:Slit3 UTSW 11 35,594,136 (GRCm39) missense probably damaging 0.98
R9068:Slit3 UTSW 11 35,574,917 (GRCm39) missense probably damaging 1.00
R9088:Slit3 UTSW 11 35,012,463 (GRCm39) missense possibly damaging 0.86
R9266:Slit3 UTSW 11 35,598,808 (GRCm39) missense probably damaging 0.98
R9539:Slit3 UTSW 11 35,589,155 (GRCm39) nonsense probably null
R9636:Slit3 UTSW 11 35,594,088 (GRCm39) missense probably damaging 0.97
X0028:Slit3 UTSW 11 35,455,464 (GRCm39) missense probably damaging 0.99
Z1176:Slit3 UTSW 11 35,598,751 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGATAAGGCCAGGGCTTTG -3'
(R):5'- CCGAGCTTCCTGATCACATAGC -3'

Sequencing Primer
(F):5'- TTGGCCTGCTAACCCTGAG -3'
(R):5'- TTCCTGATCACATAGCGGACCG -3'
Posted On 2017-03-31