Mutagenetix > Incidental Mutation

Incidental Mutation 'R5964:Dlg5'

471972

Institutional Source

Beutler Lab

Gene Symbol

Dlg5

Ensembl Gene

ENSMUSG00000021782

Gene Name

discs large MAGUK scaffold protein 5

Synonyms

4933429D20Rik

MMRRC Submission

044149-MU

Accession Numbers

Genbank: NM_001163513; MGI: 1918478

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5964 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

24133953-24245920 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 24164089 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 744 (V744A)

Ref Sequence

ENSEMBL: ENSMUSP00000087879 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042009] [ENSMUST00000073687] [ENSMUST00000090398]

AlphaFold

E9Q9R9

Predicted Effect

probably benign
Transcript: ENSMUST00000042009
AA Change: V395A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000044852
Gene: ENSMUSG00000021782
AA Change: V395A

Domain	Start	End	E-Value	Type
coiled coil region	20	247	N/A	INTRINSIC
low complexity region	261	274	N/A	INTRINSIC
PDZ	279	356	2.02e-10	SMART
PDZ	364	447	9.5e-16	SMART
low complexity region	510	517	N/A	INTRINSIC
low complexity region	692	711	N/A	INTRINSIC
low complexity region	903	918	N/A	INTRINSIC
PDZ	1009	1080	2.1e-17	SMART
PDZ	1164	1236	2.97e-8	SMART
SH3	1250	1314	3.73e-7	SMART
low complexity region	1338	1358	N/A	INTRINSIC
GuKc	1375	1561	5.43e-53	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000073687
AA Change: V721A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000073367
Gene: ENSMUSG00000021782
AA Change: V721A

Domain	Start	End	E-Value	Type
low complexity region	8	19	N/A	INTRINSIC
low complexity region	22	36	N/A	INTRINSIC
low complexity region	44	66	N/A	INTRINSIC
Pfam:Takusan	104	191	1.4e-27	PFAM
coiled coil region	308	578	N/A	INTRINSIC
low complexity region	592	605	N/A	INTRINSIC
PDZ	610	687	2.02e-10	SMART
PDZ	695	773	1.25e-15	SMART
low complexity region	836	843	N/A	INTRINSIC
low complexity region	1018	1037	N/A	INTRINSIC
low complexity region	1229	1244	N/A	INTRINSIC
PDZ	1335	1406	2.1e-17	SMART
PDZ	1490	1562	2.97e-8	SMART
SH3	1576	1640	3.73e-7	SMART
low complexity region	1664	1684	N/A	INTRINSIC
GuKc	1701	1887	5.43e-53	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000090398
AA Change: V744A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000087879
Gene: ENSMUSG00000021782
AA Change: V744A

Domain	Start	End	E-Value	Type
low complexity region	8	19	N/A	INTRINSIC
low complexity region	22	36	N/A	INTRINSIC
low complexity region	44	66	N/A	INTRINSIC
low complexity region	109	123	N/A	INTRINSIC
Pfam:Takusan	128	213	6e-33	PFAM
coiled coil region	331	601	N/A	INTRINSIC
low complexity region	615	628	N/A	INTRINSIC
PDZ	633	710	2.02e-10	SMART
PDZ	718	796	1.25e-15	SMART
low complexity region	859	866	N/A	INTRINSIC
low complexity region	1041	1060	N/A	INTRINSIC
low complexity region	1252	1267	N/A	INTRINSIC
PDZ	1358	1429	2.1e-17	SMART
PDZ	1513	1585	2.97e-8	SMART
SH3	1599	1663	3.73e-7	SMART
low complexity region	1687	1707	N/A	INTRINSIC
GuKc	1724	1910	5.43e-53	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.2%

Validation Efficiency

96% (87/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of discs large (DLG) homologs, a subset of the membrane-associated guanylate kinase (MAGUK) superfamily. The MAGUK proteins are composed of a catalytically inactive guanylate kinase domain, in addition to PDZ and SH3 domains, and are thought to function as scaffolding molecules at sites of cell-cell contact. The protein encoded by this gene localizes to the plasma membrane and cytoplasm, and interacts with components of adherens junctions and the cytoskeleton. It is proposed to function in the transmission of extracellular signals to the cytoskeleton and in the maintenance of epithelial cell structure. Alternative splice variants have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit growth retardation, hydroencephaly, abnormal brain morphology, abnormal neurogenesis, kidney cysts, ureter defects, and abnormal kidney morphology. [provided by MGI curators]

Allele List at MGI

All alleles(19) : Targeted, other(1) Gene trapped(18)

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam15	G	A	3: 89,343,567	Q581*	probably null	Het
Agl	A	G	3: 116,793,774	V44A	probably damaging	Het
Alpk3	T	A	7: 81,092,260	D608E	possibly damaging	Het
Aspm	C	A	1: 139,455,227		probably benign	Het
Bbs2	T	C	8: 94,068,367	N692S	probably benign	Het
Bend4	A	G	5: 67,417,818	I240T	probably benign	Het
Casp8	G	T	1: 58,833,736	R277L	possibly damaging	Het
Ccdc61	A	T	7: 18,900,940	I123N	probably damaging	Het
Ccr9	T	G	9: 123,779,434	I60M	probably benign	Het
Cd163	T	A	6: 124,326,572	W1066R	probably benign	Het
Cd226	A	T	18: 89,207,183	H68L	probably benign	Het
Cdkn3	T	A	14: 46,767,217	C79S	probably null	Het
Cnnm1	A	T	19: 43,469,723	E658V	probably benign	Het
Cog7	T	C	7: 121,956,029	R304G	probably damaging	Het
Cpt1a	T	A	19: 3,365,760	V286E	possibly damaging	Het
Creg2	C	A	1: 39,624,954	R212L	probably benign	Het
Cyp26a1	T	G	19: 37,699,962	S311A	probably damaging	Het
Cyp2b10	T	C	7: 25,926,223	Y484H	probably benign	Het
Cyp3a44	T	A	5: 145,788,467	Y308F	possibly damaging	Het
Dlgap2	T	A	8: 14,727,128	Y124*	probably null	Het
Dnah3	T	C	7: 119,922,880	D4030G	probably benign	Het
Dnah5	A	G	15: 28,458,584	T4456A	possibly damaging	Het
Dtx2	T	A	5: 136,023,699	V347D	probably benign	Het
Gigyf2	C	T	1: 87,407,167	T294M	probably damaging	Het
Gli3	C	G	13: 15,726,162	S1378*	probably null	Het
Gm884	A	G	11: 103,542,120	S1232P	possibly damaging	Het
Gnao1	G	A	8: 93,966,999	D337N	probably benign	Het
Gp2	T	A	7: 119,449,129	Q422L	probably benign	Het
Ifit1	T	A	19: 34,648,469	M335K	possibly damaging	Het
Ism1	T	C	2: 139,678,757	S30P	probably benign	Het
Itgax	A	G	7: 128,140,447	D677G	probably damaging	Het
Kansl1l	G	A	1: 66,725,922	A442V	probably damaging	Het
Kif13a	T	C	13: 46,771,524	I311M	probably damaging	Het
Lsm14b	T	A	2: 180,031,425	S84R	probably benign	Het
Lzts3	A	G	2: 130,636,288	Y297H	probably damaging	Het
Map4k3	A	G	17: 80,644,762	I205T	probably damaging	Het
Matn2	A	T	15: 34,410,165	N501I	probably damaging	Het
Mctp2	T	C	7: 72,103,177	E776G	probably damaging	Het
Mex3d	A	T	10: 80,382,587	N265K	probably damaging	Het
Myo5a	A	G	9: 75,203,833	T1534A	probably benign	Het
Ncoa7	T	C	10: 30,704,636	M35V	probably damaging	Het
Nek4	G	A	14: 30,957,079		probably null	Het
Ngrn	T	C	7: 80,261,933		probably null	Het
Nlrp1a	T	A	11: 71,123,020	Q468L	probably benign	Het
Olfr1450	A	C	19: 12,954,531	Q314P	probably benign	Het
Olfr743	T	A	14: 50,534,198	M262K	probably damaging	Het
Phtf2	T	C	5: 20,775,934	D433G	probably damaging	Het
Prdm13	G	A	4: 21,683,852	Q140*	probably null	Het
Prtg	G	A	9: 72,892,254	G778E	probably benign	Het
Pum3	T	C	19: 27,420,051	E308G	probably damaging	Het
Pwp1	T	G	10: 85,882,886	F306V	probably damaging	Het
Rab24	A	T	13: 55,321,576	Y27N	probably damaging	Het
Rnf215	T	C	11: 4,135,898	F126L	probably benign	Het
Samd13	A	T	3: 146,680,696		probably benign	Het
Serac1	T	A	17: 6,065,049	H213L	probably benign	Het
Slc45a3	A	G	1: 131,978,073	E278G	probably damaging	Het
Slit3	C	T	11: 35,700,236	R1292C	probably damaging	Het
Slx4	A	T	16: 4,000,951		probably null	Het
Smarca4	C	A	9: 21,647,430	T631K	probably benign	Het
Snx16	C	T	3: 10,434,481	R163Q	possibly damaging	Het
Stk40	T	C	4: 126,128,895	V140A	probably damaging	Het
Tcf12	A	T	9: 71,868,240	D409E	probably damaging	Het
Tgfbr2	G	T	9: 116,110,255	T168K	possibly damaging	Het
Ticam1	G	T	17: 56,271,703	H131N	probably damaging	Het
Ttn	C	A	2: 76,713,511	E31298*	probably null	Het
Ttn	C	A	2: 76,829,888	R7458I	possibly damaging	Het
Usp7	A	G	16: 8,712,102	V133A	possibly damaging	Het
Wbp1l	C	T	19: 46,654,180	R191*	probably null	Het
Wdfy4	T	C	14: 33,106,011	E1118G	probably damaging	Het
Zfp81	G	C	17: 33,336,845	P3A	probably damaging	Het
Znhit6	A	G	3: 145,576,933	K21R	possibly damaging	Het

Other mutations in Dlg5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Dlg5	APN	14	24191161	missense	probably damaging	0.99
IGL00164:Dlg5	APN	14	24158464	missense	possibly damaging	0.89
IGL00767:Dlg5	APN	14	24165285	missense	probably damaging	1.00
IGL01284:Dlg5	APN	14	24146197	missense	probably damaging	1.00
IGL01328:Dlg5	APN	14	24202351	missense	probably damaging	0.98
IGL01532:Dlg5	APN	14	24158592	missense	probably benign
IGL01621:Dlg5	APN	14	24148221	missense	probably damaging	1.00
IGL01649:Dlg5	APN	14	24138691	missense	probably damaging	1.00
IGL01733:Dlg5	APN	14	24170449	missense	probably damaging	1.00
IGL02048:Dlg5	APN	14	24172203	missense	possibly damaging	0.87
IGL02103:Dlg5	APN	14	24144346	missense	probably damaging	1.00
IGL02138:Dlg5	APN	14	24158351	missense	probably benign
IGL02146:Dlg5	APN	14	24202361	missense	probably damaging	0.99
IGL02392:Dlg5	APN	14	24150209	missense	probably damaging	1.00
IGL02427:Dlg5	APN	14	24166207	missense	probably damaging	1.00
IGL02643:Dlg5	APN	14	24191182	missense	probably damaging	1.00
IGL02649:Dlg5	APN	14	24146251	missense	probably damaging	0.96
IGL02933:Dlg5	APN	14	24158499	missense	probably benign	0.06
IGL02965:Dlg5	APN	14	24172023	missense	probably damaging	1.00
IGL02988:Dlg5	APN	14	24166255	missense	probably damaging	1.00
IGL03351:Dlg5	APN	14	24170454	missense	probably benign	0.03
legerdemain	UTSW	14	24164547	missense	probably damaging	1.00
R0123:Dlg5	UTSW	14	24147206	missense	probably benign
R0131:Dlg5	UTSW	14	24138649	missense	probably damaging	1.00
R0709:Dlg5	UTSW	14	24146255	missense	probably damaging	1.00
R0920:Dlg5	UTSW	14	24176397	missense	probably damaging	1.00
R0924:Dlg5	UTSW	14	24135577	missense	probably damaging	1.00
R0930:Dlg5	UTSW	14	24135577	missense	probably damaging	1.00
R0981:Dlg5	UTSW	14	24154631	missense	probably damaging	1.00
R1402:Dlg5	UTSW	14	24176608	missense	probably benign	0.06
R1402:Dlg5	UTSW	14	24176608	missense	probably benign	0.06
R1438:Dlg5	UTSW	14	24154605	missense	possibly damaging	0.94
R1449:Dlg5	UTSW	14	24135643	missense	possibly damaging	0.82
R1465:Dlg5	UTSW	14	24154696	splice site	probably null
R1465:Dlg5	UTSW	14	24154696	splice site	probably null
R1543:Dlg5	UTSW	14	24144448	missense	probably damaging	1.00
R1824:Dlg5	UTSW	14	24149444	missense	probably benign	0.28
R1899:Dlg5	UTSW	14	24148300	missense	probably damaging	1.00
R1920:Dlg5	UTSW	14	24176571	missense	probably damaging	1.00
R1921:Dlg5	UTSW	14	24176571	missense	probably damaging	1.00
R1951:Dlg5	UTSW	14	24156469	splice site	probably benign
R1968:Dlg5	UTSW	14	24164119	nonsense	probably null
R2049:Dlg5	UTSW	14	24154647	missense	probably damaging	1.00
R2070:Dlg5	UTSW	14	24136635	missense	probably damaging	1.00
R2117:Dlg5	UTSW	14	24177758	nonsense	probably null
R2139:Dlg5	UTSW	14	24170544	missense	probably damaging	1.00
R2153:Dlg5	UTSW	14	24137157	missense	probably damaging	1.00
R2283:Dlg5	UTSW	14	24158663	missense	probably benign	0.00
R2293:Dlg5	UTSW	14	24158112	missense	probably benign
R2356:Dlg5	UTSW	14	24170428	critical splice donor site	probably null
R2362:Dlg5	UTSW	14	24158687	missense	probably benign	0.04
R2513:Dlg5	UTSW	14	24164525	missense	probably damaging	1.00
R3084:Dlg5	UTSW	14	24166190	missense	probably damaging	1.00
R3086:Dlg5	UTSW	14	24166190	missense	probably damaging	1.00
R3750:Dlg5	UTSW	14	24165260	missense	probably damaging	1.00
R3780:Dlg5	UTSW	14	24190310	unclassified	probably benign
R3782:Dlg5	UTSW	14	24190310	unclassified	probably benign
R3828:Dlg5	UTSW	14	24146158	missense	probably damaging	0.99
R4079:Dlg5	UTSW	14	24148260	missense	possibly damaging	0.94
R4393:Dlg5	UTSW	14	24177989	critical splice acceptor site	probably null
R4615:Dlg5	UTSW	14	24158168	missense	probably damaging	1.00
R4664:Dlg5	UTSW	14	24137181	missense	possibly damaging	0.90
R4712:Dlg5	UTSW	14	24177983	missense	possibly damaging	0.94
R4796:Dlg5	UTSW	14	24144383	missense	probably damaging	1.00
R4801:Dlg5	UTSW	14	24154689	missense	probably damaging	1.00
R4802:Dlg5	UTSW	14	24154689	missense	probably damaging	1.00
R4946:Dlg5	UTSW	14	24154361	missense	probably damaging	0.99
R5022:Dlg5	UTSW	14	24136622	missense	probably damaging	1.00
R5023:Dlg5	UTSW	14	24136622	missense	probably damaging	1.00
R5057:Dlg5	UTSW	14	24136622	missense	probably damaging	1.00
R5234:Dlg5	UTSW	14	24192862	missense	probably damaging	0.98
R5561:Dlg5	UTSW	14	24177792	missense	probably benign	0.03
R5567:Dlg5	UTSW	14	24192913	nonsense	probably null
R5570:Dlg5	UTSW	14	24192913	nonsense	probably null
R5640:Dlg5	UTSW	14	24170461	missense	probably damaging	1.00
R5646:Dlg5	UTSW	14	24158699	missense	probably damaging	1.00
R5711:Dlg5	UTSW	14	24150648	missense	probably damaging	1.00
R5810:Dlg5	UTSW	14	24146254	missense	probably damaging	0.99
R5900:Dlg5	UTSW	14	24149447	missense	probably damaging	1.00
R6190:Dlg5	UTSW	14	24190438	missense	probably damaging	0.99
R6240:Dlg5	UTSW	14	24149528	splice site	probably null
R6276:Dlg5	UTSW	14	24164568	missense	probably damaging	1.00
R6339:Dlg5	UTSW	14	24158060	missense	probably damaging	1.00
R6508:Dlg5	UTSW	14	24138706	missense	probably benign	0.45
R6527:Dlg5	UTSW	14	24190448	missense	possibly damaging	0.73
R6593:Dlg5	UTSW	14	24150652	missense	probably benign	0.01
R6687:Dlg5	UTSW	14	24190373	missense	probably damaging	1.00
R6965:Dlg5	UTSW	14	24149430	missense	probably damaging	1.00
R7051:Dlg5	UTSW	14	24146195	missense	possibly damaging	0.93
R7075:Dlg5	UTSW	14	24177797	missense	possibly damaging	0.49
R7149:Dlg5	UTSW	14	24190424	missense	probably benign	0.00
R7182:Dlg5	UTSW	14	24244856	missense
R7203:Dlg5	UTSW	14	24138655	missense	probably damaging	1.00
R7216:Dlg5	UTSW	14	24136638	nonsense	probably null
R7359:Dlg5	UTSW	14	24164547	missense	probably damaging	1.00
R7466:Dlg5	UTSW	14	24245212	missense	probably damaging	1.00
R7485:Dlg5	UTSW	14	24148322	missense	probably benign
R7485:Dlg5	UTSW	14	24177839	missense	probably damaging	0.98
R7629:Dlg5	UTSW	14	24245212	missense	probably damaging	1.00
R7666:Dlg5	UTSW	14	24157799	missense	probably damaging	1.00
R7804:Dlg5	UTSW	14	24165320	missense	possibly damaging	0.46
R7861:Dlg5	UTSW	14	24245212	missense	probably damaging	1.00
R7862:Dlg5	UTSW	14	24245212	missense	probably damaging	1.00
R7864:Dlg5	UTSW	14	24245212	missense	probably damaging	1.00
R7874:Dlg5	UTSW	14	24135619	missense	probably damaging	1.00
R7913:Dlg5	UTSW	14	24137124	splice site	probably null
R7981:Dlg5	UTSW	14	24158145	missense	probably benign
R8147:Dlg5	UTSW	14	24158327	missense	probably benign	0.07
R8204:Dlg5	UTSW	14	24160252	missense	probably damaging	1.00
R8206:Dlg5	UTSW	14	24160268	missense	possibly damaging	0.62
R8287:Dlg5	UTSW	14	24164385	missense	probably benign	0.40
R8296:Dlg5	UTSW	14	24148260	missense	possibly damaging	0.94
R8317:Dlg5	UTSW	14	24191230	missense	probably damaging	0.98
R8327:Dlg5	UTSW	14	24146320	missense	probably damaging	0.99
R8352:Dlg5	UTSW	14	24191193	missense	probably damaging	1.00
R8353:Dlg5	UTSW	14	24158145	missense	probably benign
R8409:Dlg5	UTSW	14	24176478	missense	probably damaging	1.00
R8452:Dlg5	UTSW	14	24191193	missense	probably damaging	1.00
R8453:Dlg5	UTSW	14	24158145	missense	probably benign
R8540:Dlg5	UTSW	14	24158699	missense	probably damaging	1.00
R8701:Dlg5	UTSW	14	24176700	missense	probably benign	0.04
R8925:Dlg5	UTSW	14	24156479	missense
R8927:Dlg5	UTSW	14	24156479	missense
R9025:Dlg5	UTSW	14	24149478	missense	probably benign	0.00
R9102:Dlg5	UTSW	14	24149499	missense	probably damaging	1.00
R9138:Dlg5	UTSW	14	24245308	missense	probably damaging	0.98
R9165:Dlg5	UTSW	14	24146241	missense	probably damaging	1.00
R9250:Dlg5	UTSW	14	24190475	missense	probably benign	0.07
R9267:Dlg5	UTSW	14	24154677	missense	probably damaging	1.00
R9269:Dlg5	UTSW	14	24192813	missense	probably damaging	0.99
R9291:Dlg5	UTSW	14	24191161	missense	probably damaging	0.99
R9387:Dlg5	UTSW	14	24147100	missense	probably damaging	0.99
R9729:Dlg5	UTSW	14	24154613	missense	probably benign	0.00
RF005:Dlg5	UTSW	14	24158493	nonsense	probably null
YA93:Dlg5	UTSW	14	24155133	unclassified	probably benign
Z1088:Dlg5	UTSW	14	24158094	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTGACTCAGCACTTCCTTAGG -3'
(R):5'- TTGTGGGATCACCTTGTTCC -3'

Sequencing Primer
(F):5'- AGGGAAAGGGCTTATTTTTAATGTTC -3'
(R):5'- AGTGCCTGACTCACCAGAGAG -3'

Posted On

2017-03-31