Mutagenetix > Incidental Mutation

Incidental Mutation 'R5964:Nek4'

471973

Institutional Source

Beutler Lab

Gene Symbol

Nek4

Ensembl Gene

ENSMUSG00000021918

Gene Name

NIMA (never in mitosis gene a)-related expressed kinase 4

Synonyms

MMRRC Submission

044149-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.324) question?

Stock #

R5964 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30951377-30988821 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

G to A at 30957079 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000154090 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050171] [ENSMUST00000226551] [ENSMUST00000226833] [ENSMUST00000228328]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000050171

SMART Domains

Protein: ENSMUSP00000057915
Gene: ENSMUSG00000021918

Domain	Start	End	E-Value	Type
S_TKc	6	261	6.93e-91	SMART
low complexity region	429	439	N/A	INTRINSIC
low complexity region	627	647	N/A	INTRINSIC
low complexity region	751	767	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000226146

Predicted Effect

probably null
Transcript: ENSMUST00000226551

Predicted Effect

probably null
Transcript: ENSMUST00000226833

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227199

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227602

Predicted Effect

probably null
Transcript: ENSMUST00000228328

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228392

Meta Mutation Damage Score

0.9488

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.2%

Validation Efficiency

96% (87/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine protein kinase required for normal entry into replicative senescence. The encoded protein also is involved in cell cycle arrest in response to double-stranded DNA damage. Finally, this protein plays a role in maintaining cilium integrity, and defects in this gene have been associated with ciliopathies. [provided by RefSeq, Jan 2017]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam15	G	A	3: 89,343,567	Q581*	probably null	Het
Agl	A	G	3: 116,793,774	V44A	probably damaging	Het
Alpk3	T	A	7: 81,092,260	D608E	possibly damaging	Het
Aspm	C	A	1: 139,455,227		probably benign	Het
Bbs2	T	C	8: 94,068,367	N692S	probably benign	Het
Bend4	A	G	5: 67,417,818	I240T	probably benign	Het
Casp8	G	T	1: 58,833,736	R277L	possibly damaging	Het
Ccdc61	A	T	7: 18,900,940	I123N	probably damaging	Het
Ccr9	T	G	9: 123,779,434	I60M	probably benign	Het
Cd163	T	A	6: 124,326,572	W1066R	probably benign	Het
Cd226	A	T	18: 89,207,183	H68L	probably benign	Het
Cdkn3	T	A	14: 46,767,217	C79S	probably null	Het
Cnnm1	A	T	19: 43,469,723	E658V	probably benign	Het
Cog7	T	C	7: 121,956,029	R304G	probably damaging	Het
Cpt1a	T	A	19: 3,365,760	V286E	possibly damaging	Het
Creg2	C	A	1: 39,624,954	R212L	probably benign	Het
Cyp26a1	T	G	19: 37,699,962	S311A	probably damaging	Het
Cyp2b10	T	C	7: 25,926,223	Y484H	probably benign	Het
Cyp3a44	T	A	5: 145,788,467	Y308F	possibly damaging	Het
Dlg5	A	G	14: 24,164,089	V744A	probably benign	Het
Dlgap2	T	A	8: 14,727,128	Y124*	probably null	Het
Dnah3	T	C	7: 119,922,880	D4030G	probably benign	Het
Dnah5	A	G	15: 28,458,584	T4456A	possibly damaging	Het
Dtx2	T	A	5: 136,023,699	V347D	probably benign	Het
Gigyf2	C	T	1: 87,407,167	T294M	probably damaging	Het
Gli3	C	G	13: 15,726,162	S1378*	probably null	Het
Gm884	A	G	11: 103,542,120	S1232P	possibly damaging	Het
Gnao1	G	A	8: 93,966,999	D337N	probably benign	Het
Gp2	T	A	7: 119,449,129	Q422L	probably benign	Het
Ifit1	T	A	19: 34,648,469	M335K	possibly damaging	Het
Ism1	T	C	2: 139,678,757	S30P	probably benign	Het
Itgax	A	G	7: 128,140,447	D677G	probably damaging	Het
Kansl1l	G	A	1: 66,725,922	A442V	probably damaging	Het
Kif13a	T	C	13: 46,771,524	I311M	probably damaging	Het
Lsm14b	T	A	2: 180,031,425	S84R	probably benign	Het
Lzts3	A	G	2: 130,636,288	Y297H	probably damaging	Het
Map4k3	A	G	17: 80,644,762	I205T	probably damaging	Het
Matn2	A	T	15: 34,410,165	N501I	probably damaging	Het
Mctp2	T	C	7: 72,103,177	E776G	probably damaging	Het
Mex3d	A	T	10: 80,382,587	N265K	probably damaging	Het
Myo5a	A	G	9: 75,203,833	T1534A	probably benign	Het
Ncoa7	T	C	10: 30,704,636	M35V	probably damaging	Het
Ngrn	T	C	7: 80,261,933		probably null	Het
Nlrp1a	T	A	11: 71,123,020	Q468L	probably benign	Het
Olfr1450	A	C	19: 12,954,531	Q314P	probably benign	Het
Olfr743	T	A	14: 50,534,198	M262K	probably damaging	Het
Phtf2	T	C	5: 20,775,934	D433G	probably damaging	Het
Prdm13	G	A	4: 21,683,852	Q140*	probably null	Het
Prtg	G	A	9: 72,892,254	G778E	probably benign	Het
Pum3	T	C	19: 27,420,051	E308G	probably damaging	Het
Pwp1	T	G	10: 85,882,886	F306V	probably damaging	Het
Rab24	A	T	13: 55,321,576	Y27N	probably damaging	Het
Rnf215	T	C	11: 4,135,898	F126L	probably benign	Het
Samd13	A	T	3: 146,680,696		probably benign	Het
Serac1	T	A	17: 6,065,049	H213L	probably benign	Het
Slc45a3	A	G	1: 131,978,073	E278G	probably damaging	Het
Slit3	C	T	11: 35,700,236	R1292C	probably damaging	Het
Slx4	A	T	16: 4,000,951		probably null	Het
Smarca4	C	A	9: 21,647,430	T631K	probably benign	Het
Snx16	C	T	3: 10,434,481	R163Q	possibly damaging	Het
Stk40	T	C	4: 126,128,895	V140A	probably damaging	Het
Tcf12	A	T	9: 71,868,240	D409E	probably damaging	Het
Tgfbr2	G	T	9: 116,110,255	T168K	possibly damaging	Het
Ticam1	G	T	17: 56,271,703	H131N	probably damaging	Het
Ttn	C	A	2: 76,713,511	E31298*	probably null	Het
Ttn	C	A	2: 76,829,888	R7458I	possibly damaging	Het
Usp7	A	G	16: 8,712,102	V133A	possibly damaging	Het
Wbp1l	C	T	19: 46,654,180	R191*	probably null	Het
Wdfy4	T	C	14: 33,106,011	E1118G	probably damaging	Het
Zfp81	G	C	17: 33,336,845	P3A	probably damaging	Het
Znhit6	A	G	3: 145,576,933	K21R	possibly damaging	Het

Other mutations in Nek4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01124:Nek4	APN	14	30970262	missense	probably benign	0.00
IGL01746:Nek4	APN	14	30977584	splice site	probably null
IGL02403:Nek4	APN	14	30964051	nonsense	probably null
IGL02606:Nek4	APN	14	30963959	missense	probably benign	0.01
IGL03261:Nek4	APN	14	30975290	missense	probably benign	0.05
R0266:Nek4	UTSW	14	30957296	missense	probably damaging	1.00
R0436:Nek4	UTSW	14	30970472	missense	probably damaging	0.96
R0520:Nek4	UTSW	14	30959306	splice site	probably benign
R0523:Nek4	UTSW	14	30980038	missense	probably benign	0.18
R0849:Nek4	UTSW	14	30957296	missense	probably damaging	1.00
R1167:Nek4	UTSW	14	30974345	missense	possibly damaging	0.68
R1465:Nek4	UTSW	14	30956887	missense	probably damaging	1.00
R1465:Nek4	UTSW	14	30956887	missense	probably damaging	1.00
R1484:Nek4	UTSW	14	30982333	missense	possibly damaging	0.56
R1563:Nek4	UTSW	14	30982451	missense	probably damaging	1.00
R1616:Nek4	UTSW	14	30987137	missense	probably damaging	0.98
R1670:Nek4	UTSW	14	30982427	missense	probably damaging	1.00
R1991:Nek4	UTSW	14	30956953	missense	probably damaging	0.98
R2045:Nek4	UTSW	14	30953923	missense	probably damaging	1.00
R2157:Nek4	UTSW	14	30979968	splice site	probably null
R2925:Nek4	UTSW	14	30951710	missense	probably benign	0.29
R4342:Nek4	UTSW	14	30953906	missense	probably damaging	1.00
R6030:Nek4	UTSW	14	30956933	missense	probably damaging	1.00
R6030:Nek4	UTSW	14	30956933	missense	probably damaging	1.00
R6171:Nek4	UTSW	14	30970347	missense	probably benign	0.01
R7145:Nek4	UTSW	14	30982348	missense	probably damaging	0.96
R7286:Nek4	UTSW	14	30957292	missense	probably damaging	1.00
R8098:Nek4	UTSW	14	30963951	missense	probably benign	0.03
R8300:Nek4	UTSW	14	30970395	missense
R8397:Nek4	UTSW	14	30970548	missense	possibly damaging	0.77
R8481:Nek4	UTSW	14	30964034	missense	probably damaging	0.97
R8962:Nek4	UTSW	14	30953958	missense	probably damaging	1.00
R8988:Nek4	UTSW	14	30963967	missense
R9003:Nek4	UTSW	14	30982514	missense	probably benign	0.09
R9531:Nek4	UTSW	14	30970350	missense	probably benign	0.01
R9608:Nek4	UTSW	14	30953947	missense	probably damaging	0.99
R9748:Nek4	UTSW	14	30987157	missense	possibly damaging	0.63
R9777:Nek4	UTSW	14	30984444	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- CCTTCATCGAGATCTGAAAACTC -3'
(R):5'- GGTGGCCATTTCATATACACAGC -3'

Sequencing Primer
(F):5'- ACTCAGAATGTCTTCTTAACAAGAAC -3'
(R):5'- GGCCATTTCATATACACAGCATCCC -3'

Posted On

2017-03-31