Mutagenetix > Incidental Mutation

Incidental Mutation 'R5964:Wdfy4'

471974

Institutional Source

Beutler Lab

Gene Symbol

Wdfy4

Ensembl Gene

ENSMUSG00000051506

Gene Name

WD repeat and FYVE domain containing 4

Synonyms

MMRRC Submission

044149-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5964 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

32959547-33185508 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 33106011 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1118 (E1118G)

Ref Sequence

ENSEMBL: ENSMUSP00000117068 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061753] [ENSMUST00000130509]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000061753
AA Change: E1073G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000057556
Gene: ENSMUSG00000051506
AA Change: E1073G

Domain	Start	End	E-Value	Type
low complexity region	69	77	N/A	INTRINSIC
low complexity region	204	222	N/A	INTRINSIC
low complexity region	508	522	N/A	INTRINSIC
low complexity region	618	632	N/A	INTRINSIC
low complexity region	644	661	N/A	INTRINSIC
low complexity region	1585	1604	N/A	INTRINSIC
low complexity region	1899	1909	N/A	INTRINSIC
Pfam:PH_BEACH	2237	2348	1.2e-9	PFAM
Beach	2378	2660	3.69e-196	SMART
WD40	2761	2801	1.98e1	SMART
WD40	2811	2850	5.18e-7	SMART
WD40	2853	2891	9.94e-1	SMART
WD40	2893	2940	3.17e-2	SMART
WD40	2986	3021	3.31e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000130509
AA Change: E1118G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000117068
Gene: ENSMUSG00000051506
AA Change: E1118G

Domain	Start	End	E-Value	Type
low complexity region	69	77	N/A	INTRINSIC
low complexity region	204	222	N/A	INTRINSIC
low complexity region	508	522	N/A	INTRINSIC
low complexity region	618	632	N/A	INTRINSIC
low complexity region	644	661	N/A	INTRINSIC
low complexity region	1596	1615	N/A	INTRINSIC
low complexity region	1795	1819	N/A	INTRINSIC
low complexity region	2019	2029	N/A	INTRINSIC
Pfam:PH_BEACH	2362	2473	1.2e-9	PFAM
Beach	2503	2785	3.69e-196	SMART
WD40	2886	2926	1.98e1	SMART
WD40	2936	2975	5.18e-7	SMART
WD40	2978	3016	9.94e-1	SMART
WD40	3018	3065	3.17e-2	SMART
WD40	3111	3146	3.31e0	SMART

Meta Mutation Damage Score

0.2966

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.2%

Validation Efficiency

96% (87/91)

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam15	G	A	3: 89,343,567	Q581*	probably null	Het
Agl	A	G	3: 116,793,774	V44A	probably damaging	Het
Alpk3	T	A	7: 81,092,260	D608E	possibly damaging	Het
Aspm	C	A	1: 139,455,227		probably benign	Het
Bbs2	T	C	8: 94,068,367	N692S	probably benign	Het
Bend4	A	G	5: 67,417,818	I240T	probably benign	Het
Casp8	G	T	1: 58,833,736	R277L	possibly damaging	Het
Ccdc61	A	T	7: 18,900,940	I123N	probably damaging	Het
Ccr9	T	G	9: 123,779,434	I60M	probably benign	Het
Cd163	T	A	6: 124,326,572	W1066R	probably benign	Het
Cd226	A	T	18: 89,207,183	H68L	probably benign	Het
Cdkn3	T	A	14: 46,767,217	C79S	probably null	Het
Cnnm1	A	T	19: 43,469,723	E658V	probably benign	Het
Cog7	T	C	7: 121,956,029	R304G	probably damaging	Het
Cpt1a	T	A	19: 3,365,760	V286E	possibly damaging	Het
Creg2	C	A	1: 39,624,954	R212L	probably benign	Het
Cyp26a1	T	G	19: 37,699,962	S311A	probably damaging	Het
Cyp2b10	T	C	7: 25,926,223	Y484H	probably benign	Het
Cyp3a44	T	A	5: 145,788,467	Y308F	possibly damaging	Het
Dlg5	A	G	14: 24,164,089	V744A	probably benign	Het
Dlgap2	T	A	8: 14,727,128	Y124*	probably null	Het
Dnah3	T	C	7: 119,922,880	D4030G	probably benign	Het
Dnah5	A	G	15: 28,458,584	T4456A	possibly damaging	Het
Dtx2	T	A	5: 136,023,699	V347D	probably benign	Het
Gigyf2	C	T	1: 87,407,167	T294M	probably damaging	Het
Gli3	C	G	13: 15,726,162	S1378*	probably null	Het
Gm884	A	G	11: 103,542,120	S1232P	possibly damaging	Het
Gnao1	G	A	8: 93,966,999	D337N	probably benign	Het
Gp2	T	A	7: 119,449,129	Q422L	probably benign	Het
Ifit1	T	A	19: 34,648,469	M335K	possibly damaging	Het
Ism1	T	C	2: 139,678,757	S30P	probably benign	Het
Itgax	A	G	7: 128,140,447	D677G	probably damaging	Het
Kansl1l	G	A	1: 66,725,922	A442V	probably damaging	Het
Kif13a	T	C	13: 46,771,524	I311M	probably damaging	Het
Lsm14b	T	A	2: 180,031,425	S84R	probably benign	Het
Lzts3	A	G	2: 130,636,288	Y297H	probably damaging	Het
Map4k3	A	G	17: 80,644,762	I205T	probably damaging	Het
Matn2	A	T	15: 34,410,165	N501I	probably damaging	Het
Mctp2	T	C	7: 72,103,177	E776G	probably damaging	Het
Mex3d	A	T	10: 80,382,587	N265K	probably damaging	Het
Myo5a	A	G	9: 75,203,833	T1534A	probably benign	Het
Ncoa7	T	C	10: 30,704,636	M35V	probably damaging	Het
Nek4	G	A	14: 30,957,079		probably null	Het
Ngrn	T	C	7: 80,261,933		probably null	Het
Nlrp1a	T	A	11: 71,123,020	Q468L	probably benign	Het
Olfr1450	A	C	19: 12,954,531	Q314P	probably benign	Het
Olfr743	T	A	14: 50,534,198	M262K	probably damaging	Het
Phtf2	T	C	5: 20,775,934	D433G	probably damaging	Het
Prdm13	G	A	4: 21,683,852	Q140*	probably null	Het
Prtg	G	A	9: 72,892,254	G778E	probably benign	Het
Pum3	T	C	19: 27,420,051	E308G	probably damaging	Het
Pwp1	T	G	10: 85,882,886	F306V	probably damaging	Het
Rab24	A	T	13: 55,321,576	Y27N	probably damaging	Het
Rnf215	T	C	11: 4,135,898	F126L	probably benign	Het
Samd13	A	T	3: 146,680,696		probably benign	Het
Serac1	T	A	17: 6,065,049	H213L	probably benign	Het
Slc45a3	A	G	1: 131,978,073	E278G	probably damaging	Het
Slit3	C	T	11: 35,700,236	R1292C	probably damaging	Het
Slx4	A	T	16: 4,000,951		probably null	Het
Smarca4	C	A	9: 21,647,430	T631K	probably benign	Het
Snx16	C	T	3: 10,434,481	R163Q	possibly damaging	Het
Stk40	T	C	4: 126,128,895	V140A	probably damaging	Het
Tcf12	A	T	9: 71,868,240	D409E	probably damaging	Het
Tgfbr2	G	T	9: 116,110,255	T168K	possibly damaging	Het
Ticam1	G	T	17: 56,271,703	H131N	probably damaging	Het
Ttn	C	A	2: 76,713,511	E31298*	probably null	Het
Ttn	C	A	2: 76,829,888	R7458I	possibly damaging	Het
Usp7	A	G	16: 8,712,102	V133A	possibly damaging	Het
Wbp1l	C	T	19: 46,654,180	R191*	probably null	Het
Zfp81	G	C	17: 33,336,845	P3A	probably damaging	Het
Znhit6	A	G	3: 145,576,933	K21R	possibly damaging	Het

Other mutations in Wdfy4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Wdfy4	APN	14	33102539	missense	possibly damaging	0.93
IGL01116:Wdfy4	APN	14	32959977	missense	probably damaging	1.00
IGL01449:Wdfy4	APN	14	33104037	missense	probably damaging	0.99
IGL01567:Wdfy4	APN	14	33151661	missense	probably benign	0.01
IGL01700:Wdfy4	APN	14	33020238	splice site	probably benign
IGL01931:Wdfy4	APN	14	33155753	missense	probably damaging	1.00
IGL01981:Wdfy4	APN	14	33133716	missense	probably damaging	1.00
IGL01988:Wdfy4	APN	14	33076480	missense	possibly damaging	0.75
IGL02026:Wdfy4	APN	14	33093300	missense	probably damaging	1.00
IGL02066:Wdfy4	APN	14	33149566	missense	probably benign
IGL02468:Wdfy4	APN	14	32966432	missense	probably benign	0.01
IGL02512:Wdfy4	APN	14	33042491	missense	probably benign	0.01
IGL02597:Wdfy4	APN	14	33090861	nonsense	probably null
IGL02752:Wdfy4	APN	14	33076326	missense	probably damaging	1.00
IGL02792:Wdfy4	APN	14	33095305	missense	probably benign	0.01
IGL02826:Wdfy4	APN	14	32971750	missense	possibly damaging	0.47
IGL02903:Wdfy4	APN	14	33109650	missense	probably damaging	1.00
IGL02955:Wdfy4	APN	14	33076284	missense	probably damaging	1.00
IGL03031:Wdfy4	APN	14	33140651	missense	probably damaging	1.00
IGL03102:Wdfy4	APN	14	32966435	missense	probably damaging	1.00
IGL03123:Wdfy4	APN	14	33162870	missense	probably benign	0.01
IGL03198:Wdfy4	APN	14	33125887	missense	probably damaging	1.00
IGL03250:Wdfy4	APN	14	32977167	missense	probably damaging	0.99
IGL03277:Wdfy4	APN	14	33068904	missense	probably benign	0.01
IGL03398:Wdfy4	APN	14	33047290	missense	probably benign	0.14
dodgers	UTSW	14	32977106	nonsense	probably null
Dollar	UTSW	14	33020311	missense	probably damaging	1.00
Giants	UTSW	14	33070618	nonsense	probably null
gigantea	UTSW	14	32974154	critical splice donor site	probably null
kings_canyon	UTSW	14	33109519	nonsense	probably null
moro	UTSW	14	32964626	splice site	probably null
popped	UTSW	14	32966399	missense	probably damaging	0.99
sequoia	UTSW	14	33100903	critical splice donor site	probably null
Sherman	UTSW	14	33095951	missense	possibly damaging	0.89
stretched	UTSW	14	33073535	nonsense	probably null
watchtower	UTSW	14	33083639	critical splice donor site	probably null
R0014:Wdfy4	UTSW	14	33107173	missense	possibly damaging	0.72
R0067:Wdfy4	UTSW	14	33162751	missense	probably null	1.00
R0085:Wdfy4	UTSW	14	33078243	missense	possibly damaging	0.81
R0277:Wdfy4	UTSW	14	33083785	missense	possibly damaging	0.83
R0436:Wdfy4	UTSW	14	33083812	splice site	probably benign
R0496:Wdfy4	UTSW	14	33140738	splice site	probably benign
R0514:Wdfy4	UTSW	14	33080775	missense	probably benign	0.22
R0548:Wdfy4	UTSW	14	33042621	missense	probably benign
R0590:Wdfy4	UTSW	14	33041174	missense	probably benign	0.09
R0647:Wdfy4	UTSW	14	33109699	missense	possibly damaging	0.96
R0766:Wdfy4	UTSW	14	33140612	missense	probably damaging	1.00
R0981:Wdfy4	UTSW	14	33147092	missense	probably benign	0.03
R1024:Wdfy4	UTSW	14	33079966	missense	possibly damaging	0.81
R1113:Wdfy4	UTSW	14	32971738	missense	possibly damaging	0.47
R1252:Wdfy4	UTSW	14	32971772	splice site	probably null
R1415:Wdfy4	UTSW	14	33041180	missense	possibly damaging	0.60
R1475:Wdfy4	UTSW	14	33108688	missense	probably benign	0.14
R1483:Wdfy4	UTSW	14	33100966	missense	probably benign	0.41
R1490:Wdfy4	UTSW	14	33152538	critical splice donor site	probably null
R1512:Wdfy4	UTSW	14	32960808	missense	probably damaging	0.98
R1615:Wdfy4	UTSW	14	33042512	missense	probably damaging	1.00
R1628:Wdfy4	UTSW	14	32959961	missense	probably damaging	1.00
R1643:Wdfy4	UTSW	14	33073585	critical splice acceptor site	probably null
R1729:Wdfy4	UTSW	14	33096005	missense	possibly damaging	0.85
R1859:Wdfy4	UTSW	14	33103983	missense	probably damaging	0.99
R1933:Wdfy4	UTSW	14	33133344	missense	probably benign	0.08
R1957:Wdfy4	UTSW	14	32971684	missense	probably damaging	1.00
R1968:Wdfy4	UTSW	14	33106044	missense	possibly damaging	0.95
R2032:Wdfy4	UTSW	14	33146989	missense	probably benign	0.11
R2241:Wdfy4	UTSW	14	33073511	missense	possibly damaging	0.81
R2391:Wdfy4	UTSW	14	33162807	missense	possibly damaging	0.92
R2888:Wdfy4	UTSW	14	33109519	nonsense	probably null
R2889:Wdfy4	UTSW	14	33109519	nonsense	probably null
R3114:Wdfy4	UTSW	14	33089903	missense	probably damaging	0.97
R3757:Wdfy4	UTSW	14	33023374	missense	probably benign	0.17
R3758:Wdfy4	UTSW	14	33023374	missense	probably benign	0.17
R3797:Wdfy4	UTSW	14	33140645	missense	probably damaging	1.00
R3890:Wdfy4	UTSW	14	33047280	missense	probably damaging	1.00
R3892:Wdfy4	UTSW	14	33047280	missense	probably damaging	1.00
R3945:Wdfy4	UTSW	14	32966395	missense	probably damaging	0.99
R4011:Wdfy4	UTSW	14	33102680	splice site	probably benign
R4091:Wdfy4	UTSW	14	33125880	missense	possibly damaging	0.93
R4449:Wdfy4	UTSW	14	33096083	missense	probably damaging	1.00
R4585:Wdfy4	UTSW	14	33087955	missense	possibly damaging	0.89
R4628:Wdfy4	UTSW	14	33102558	missense	probably damaging	0.97
R4629:Wdfy4	UTSW	14	33102558	missense	probably damaging	0.97
R4655:Wdfy4	UTSW	14	32989936	missense	probably damaging	0.98
R4689:Wdfy4	UTSW	14	33109548	missense	possibly damaging	0.88
R4718:Wdfy4	UTSW	14	33145316	missense	probably benign	0.03
R4862:Wdfy4	UTSW	14	33100903	critical splice donor site	probably null
R4884:Wdfy4	UTSW	14	32988895	nonsense	probably null
R4894:Wdfy4	UTSW	14	33155760	missense	probably benign	0.03
R4929:Wdfy4	UTSW	14	33047256	missense	possibly damaging	0.90
R4932:Wdfy4	UTSW	14	33029013	missense	probably damaging	1.00
R5014:Wdfy4	UTSW	14	33100940	missense	probably benign	0.02
R5020:Wdfy4	UTSW	14	33079935	missense	probably damaging	1.00
R5049:Wdfy4	UTSW	14	33152670	missense	possibly damaging	0.78
R5276:Wdfy4	UTSW	14	33047275	missense	probably damaging	1.00
R5318:Wdfy4	UTSW	14	33078343	missense	possibly damaging	0.95
R5338:Wdfy4	UTSW	14	33090866	missense	probably damaging	1.00
R5349:Wdfy4	UTSW	14	32988899	missense	probably damaging	1.00
R5411:Wdfy4	UTSW	14	32960002	missense	probably damaging	1.00
R5435:Wdfy4	UTSW	14	33020311	missense	probably damaging	1.00
R5463:Wdfy4	UTSW	14	33151732	missense	probably benign	0.17
R5591:Wdfy4	UTSW	14	33107130	missense	probably benign	0.09
R5598:Wdfy4	UTSW	14	33133497	missense	probably damaging	1.00
R5654:Wdfy4	UTSW	14	33107618	splice site	probably null
R5890:Wdfy4	UTSW	14	33102577	missense	possibly damaging	0.91
R5894:Wdfy4	UTSW	14	33133360	missense	possibly damaging	0.86
R6036:Wdfy4	UTSW	14	33146990	missense	probably damaging	0.97
R6036:Wdfy4	UTSW	14	33146990	missense	probably damaging	0.97
R6074:Wdfy4	UTSW	14	33083639	critical splice donor site	probably null
R6135:Wdfy4	UTSW	14	32971711	missense	probably damaging	0.99
R6276:Wdfy4	UTSW	14	33109525	missense	possibly damaging	0.54
R6357:Wdfy4	UTSW	14	33101049	nonsense	probably null
R6370:Wdfy4	UTSW	14	33068850	missense	probably benign	0.16
R6390:Wdfy4	UTSW	14	33104094	missense	probably damaging	0.99
R6413:Wdfy4	UTSW	14	32967647	missense	probably damaging	1.00
R6450:Wdfy4	UTSW	14	33108692	missense	probably damaging	1.00
R6522:Wdfy4	UTSW	14	33146944	missense	probably damaging	0.98
R6657:Wdfy4	UTSW	14	33047251	missense	possibly damaging	0.70
R6761:Wdfy4	UTSW	14	33095951	missense	possibly damaging	0.89
R6763:Wdfy4	UTSW	14	33042512	missense	probably damaging	1.00
R6952:Wdfy4	UTSW	14	32959966	missense	probably damaging	1.00
R6985:Wdfy4	UTSW	14	33099117	missense	possibly damaging	0.68
R7024:Wdfy4	UTSW	14	32964626	splice site	probably null
R7101:Wdfy4	UTSW	14	32960820	missense
R7114:Wdfy4	UTSW	14	32971574	splice site	probably null
R7139:Wdfy4	UTSW	14	33151578	missense
R7255:Wdfy4	UTSW	14	32974282	missense
R7324:Wdfy4	UTSW	14	33047314	missense
R7379:Wdfy4	UTSW	14	33151609	missense
R7399:Wdfy4	UTSW	14	33068906	missense
R7408:Wdfy4	UTSW	14	33078307	missense
R7410:Wdfy4	UTSW	14	32974234	missense
R7411:Wdfy4	UTSW	14	33106131	missense
R7412:Wdfy4	UTSW	14	33149584	missense
R7445:Wdfy4	UTSW	14	33070618	nonsense	probably null
R7595:Wdfy4	UTSW	14	32974154	critical splice donor site	probably null
R7618:Wdfy4	UTSW	14	32985739	missense
R7622:Wdfy4	UTSW	14	33078274	missense
R7828:Wdfy4	UTSW	14	32988921	missense	possibly damaging	0.90
R7888:Wdfy4	UTSW	14	33090963	missense
R7946:Wdfy4	UTSW	14	33070748	missense
R7946:Wdfy4	UTSW	14	33104115	missense
R7986:Wdfy4	UTSW	14	33104115	missense
R7990:Wdfy4	UTSW	14	33097795	missense
R8001:Wdfy4	UTSW	14	32973535	critical splice donor site	probably null
R8010:Wdfy4	UTSW	14	32971627	missense
R8015:Wdfy4	UTSW	14	33107747	missense
R8032:Wdfy4	UTSW	14	33029086	nonsense	probably null
R8041:Wdfy4	UTSW	14	33154008	critical splice donor site	probably null
R8090:Wdfy4	UTSW	14	33104115	missense
R8092:Wdfy4	UTSW	14	33104115	missense
R8112:Wdfy4	UTSW	14	33104115	missense
R8114:Wdfy4	UTSW	14	33104115	missense
R8115:Wdfy4	UTSW	14	33104115	missense
R8117:Wdfy4	UTSW	14	32977106	nonsense	probably null
R8117:Wdfy4	UTSW	14	33104115	missense
R8118:Wdfy4	UTSW	14	33104115	missense
R8140:Wdfy4	UTSW	14	33142360	missense
R8155:Wdfy4	UTSW	14	33162819	missense
R8163:Wdfy4	UTSW	14	33151588	missense
R8293:Wdfy4	UTSW	14	32974261	missense
R8325:Wdfy4	UTSW	14	32967487	missense
R8353:Wdfy4	UTSW	14	32973624	missense	probably benign
R8370:Wdfy4	UTSW	14	33093251	missense
R8437:Wdfy4	UTSW	14	33076375	missense
R8497:Wdfy4	UTSW	14	32966399	missense	probably damaging	0.99
R8545:Wdfy4	UTSW	14	33078301	missense	probably benign	0.01
R8671:Wdfy4	UTSW	14	32971765	splice site	probably benign
R8708:Wdfy4	UTSW	14	32967532	missense
R8747:Wdfy4	UTSW	14	33152654	missense
R8794:Wdfy4	UTSW	14	33147092	missense	probably benign	0.03
R8846:Wdfy4	UTSW	14	33145148	missense
R8880:Wdfy4	UTSW	14	33073535	nonsense	probably null
R9109:Wdfy4	UTSW	14	33038747	splice site	probably null
R9131:Wdfy4	UTSW	14	33097850	missense
R9309:Wdfy4	UTSW	14	33095356	missense
R9349:Wdfy4	UTSW	14	33154039	missense
R9451:Wdfy4	UTSW	14	33133561	missense
R9563:Wdfy4	UTSW	14	32970876	missense
R9587:Wdfy4	UTSW	14	33047273	nonsense	probably null
R9599:Wdfy4	UTSW	14	33133471	missense
R9670:Wdfy4	UTSW	14	33047262	missense
R9718:Wdfy4	UTSW	14	33125936	missense
R9742:Wdfy4	UTSW	14	33088030	missense
X0028:Wdfy4	UTSW	14	33080636	missense	probably benign
X0053:Wdfy4	UTSW	14	33162942	start codon destroyed	probably null	0.99
X0062:Wdfy4	UTSW	14	33107618	splice site	probably null
Z1177:Wdfy4	UTSW	14	33087985	missense

Predicted Primers

PCR Primer
(F):5'- TACCACATATGAAAGCCAAGGG -3'
(R):5'- AGTGCCAAGCTCTGCTTCTG -3'

Sequencing Primer
(F):5'- CATATGAAAGCCAAGGGTGCAATTTC -3'
(R):5'- GAGCTCCCAGGCCGTTC -3'

Posted On

2017-03-31