Mutagenetix > Incidental Mutation

Incidental Mutation 'R5964:Olfr743'

471976

Institutional Source

Beutler Lab

Gene Symbol

Olfr743

Ensembl Gene

ENSMUSG00000094285

Gene Name

olfactory receptor 743

Synonyms

Olfr264, GA_x6K02T2PMLR-6243196-6244132, MOR106-8P, GA_x6K02T2N6FY-3870-3385, GA_x6K02T2N6FY-2320-2039, MOR106-14, Olfr265, Olfr743-ps1

MMRRC Submission

044149-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.108) question?

Stock #

R5964 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

50521839-50534955 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 50534198 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 262 (M262K)

Ref Sequence

ENSEMBL: ENSMUSP00000150946 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071294] [ENSMUST00000215793]

AlphaFold

L7N1Y2

Predicted Effect

probably damaging
Transcript: ENSMUST00000071294
AA Change: M262K

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000071263
Gene: ENSMUSG00000094285
AA Change: M262K

Domain	Start	End	E-Value	Type
Pfam:7tm_4	35	311	1.6e-56	PFAM
Pfam:7tm_1	45	294	1e-21	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000215793
AA Change: M262K

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

Meta Mutation Damage Score

0.6336

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.2%

Validation Efficiency

96% (87/91)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam15	G	A	3: 89,343,567	Q581*	probably null	Het
Agl	A	G	3: 116,793,774	V44A	probably damaging	Het
Alpk3	T	A	7: 81,092,260	D608E	possibly damaging	Het
Aspm	C	A	1: 139,455,227		probably benign	Het
Bbs2	T	C	8: 94,068,367	N692S	probably benign	Het
Bend4	A	G	5: 67,417,818	I240T	probably benign	Het
Casp8	G	T	1: 58,833,736	R277L	possibly damaging	Het
Ccdc61	A	T	7: 18,900,940	I123N	probably damaging	Het
Ccr9	T	G	9: 123,779,434	I60M	probably benign	Het
Cd163	T	A	6: 124,326,572	W1066R	probably benign	Het
Cd226	A	T	18: 89,207,183	H68L	probably benign	Het
Cdkn3	T	A	14: 46,767,217	C79S	probably null	Het
Cnnm1	A	T	19: 43,469,723	E658V	probably benign	Het
Cog7	T	C	7: 121,956,029	R304G	probably damaging	Het
Cpt1a	T	A	19: 3,365,760	V286E	possibly damaging	Het
Creg2	C	A	1: 39,624,954	R212L	probably benign	Het
Cyp26a1	T	G	19: 37,699,962	S311A	probably damaging	Het
Cyp2b10	T	C	7: 25,926,223	Y484H	probably benign	Het
Cyp3a44	T	A	5: 145,788,467	Y308F	possibly damaging	Het
Dlg5	A	G	14: 24,164,089	V744A	probably benign	Het
Dlgap2	T	A	8: 14,727,128	Y124*	probably null	Het
Dnah3	T	C	7: 119,922,880	D4030G	probably benign	Het
Dnah5	A	G	15: 28,458,584	T4456A	possibly damaging	Het
Dtx2	T	A	5: 136,023,699	V347D	probably benign	Het
Gigyf2	C	T	1: 87,407,167	T294M	probably damaging	Het
Gli3	C	G	13: 15,726,162	S1378*	probably null	Het
Gm884	A	G	11: 103,542,120	S1232P	possibly damaging	Het
Gnao1	G	A	8: 93,966,999	D337N	probably benign	Het
Gp2	T	A	7: 119,449,129	Q422L	probably benign	Het
Ifit1	T	A	19: 34,648,469	M335K	possibly damaging	Het
Ism1	T	C	2: 139,678,757	S30P	probably benign	Het
Itgax	A	G	7: 128,140,447	D677G	probably damaging	Het
Kansl1l	G	A	1: 66,725,922	A442V	probably damaging	Het
Kif13a	T	C	13: 46,771,524	I311M	probably damaging	Het
Lsm14b	T	A	2: 180,031,425	S84R	probably benign	Het
Lzts3	A	G	2: 130,636,288	Y297H	probably damaging	Het
Map4k3	A	G	17: 80,644,762	I205T	probably damaging	Het
Matn2	A	T	15: 34,410,165	N501I	probably damaging	Het
Mctp2	T	C	7: 72,103,177	E776G	probably damaging	Het
Mex3d	A	T	10: 80,382,587	N265K	probably damaging	Het
Myo5a	A	G	9: 75,203,833	T1534A	probably benign	Het
Ncoa7	T	C	10: 30,704,636	M35V	probably damaging	Het
Nek4	G	A	14: 30,957,079		probably null	Het
Ngrn	T	C	7: 80,261,933		probably null	Het
Nlrp1a	T	A	11: 71,123,020	Q468L	probably benign	Het
Olfr1450	A	C	19: 12,954,531	Q314P	probably benign	Het
Phtf2	T	C	5: 20,775,934	D433G	probably damaging	Het
Prdm13	G	A	4: 21,683,852	Q140*	probably null	Het
Prtg	G	A	9: 72,892,254	G778E	probably benign	Het
Pum3	T	C	19: 27,420,051	E308G	probably damaging	Het
Pwp1	T	G	10: 85,882,886	F306V	probably damaging	Het
Rab24	A	T	13: 55,321,576	Y27N	probably damaging	Het
Rnf215	T	C	11: 4,135,898	F126L	probably benign	Het
Samd13	A	T	3: 146,680,696		probably benign	Het
Serac1	T	A	17: 6,065,049	H213L	probably benign	Het
Slc45a3	A	G	1: 131,978,073	E278G	probably damaging	Het
Slit3	C	T	11: 35,700,236	R1292C	probably damaging	Het
Slx4	A	T	16: 4,000,951		probably null	Het
Smarca4	C	A	9: 21,647,430	T631K	probably benign	Het
Snx16	C	T	3: 10,434,481	R163Q	possibly damaging	Het
Stk40	T	C	4: 126,128,895	V140A	probably damaging	Het
Tcf12	A	T	9: 71,868,240	D409E	probably damaging	Het
Tgfbr2	G	T	9: 116,110,255	T168K	possibly damaging	Het
Ticam1	G	T	17: 56,271,703	H131N	probably damaging	Het
Ttn	C	A	2: 76,713,511	E31298*	probably null	Het
Ttn	C	A	2: 76,829,888	R7458I	possibly damaging	Het
Usp7	A	G	16: 8,712,102	V133A	possibly damaging	Het
Wbp1l	C	T	19: 46,654,180	R191*	probably null	Het
Wdfy4	T	C	14: 33,106,011	E1118G	probably damaging	Het
Zfp81	G	C	17: 33,336,845	P3A	probably damaging	Het
Znhit6	A	G	3: 145,576,933	K21R	possibly damaging	Het

Other mutations in Olfr743

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01128:Olfr743	APN	14	50533949	missense	probably damaging	1.00
IGL01551:Olfr743	APN	14	50534161	missense	probably benign
IGL02024:Olfr743	APN	14	50533850	missense	probably benign	0.00
IGL02867:Olfr743	APN	14	50533513	missense	probably benign
IGL02889:Olfr743	APN	14	50533513	missense	probably benign
IGL03195:Olfr743	APN	14	50533420	missense	probably benign
IGL03296:Olfr743	APN	14	50533945	missense	possibly damaging	0.90
R0049:Olfr743	UTSW	14	50533694	missense	probably damaging	1.00
R0049:Olfr743	UTSW	14	50533694	missense	probably damaging	1.00
R0102:Olfr743	UTSW	14	50533631	missense	probably damaging	1.00
R0556:Olfr743	UTSW	14	50533924	missense	probably benign	0.01
R0626:Olfr743	UTSW	14	50533702	missense	possibly damaging	0.78
R0661:Olfr743	UTSW	14	50534095	missense	probably benign
R0759:Olfr743	UTSW	14	50533702	missense	possibly damaging	0.78
R0761:Olfr743	UTSW	14	50533702	missense	possibly damaging	0.78
R0894:Olfr743	UTSW	14	50533702	missense	possibly damaging	0.78
R1109:Olfr743	UTSW	14	50533702	missense	possibly damaging	0.78
R1110:Olfr743	UTSW	14	50533702	missense	possibly damaging	0.78
R1312:Olfr743	UTSW	14	50534195	missense	probably benign
R1446:Olfr743	UTSW	14	50533702	missense	possibly damaging	0.78
R1470:Olfr743	UTSW	14	50533702	missense	possibly damaging	0.78
R1470:Olfr743	UTSW	14	50533702	missense	possibly damaging	0.78
R1502:Olfr743	UTSW	14	50533777	missense	possibly damaging	0.47
R1518:Olfr743	UTSW	14	50534165	missense	probably damaging	1.00
R1529:Olfr743	UTSW	14	50533702	missense	possibly damaging	0.78
R1624:Olfr743	UTSW	14	50533643	missense	probably damaging	1.00
R1646:Olfr743	UTSW	14	50533583	missense	probably benign	0.01
R1687:Olfr743	UTSW	14	50533702	missense	possibly damaging	0.78
R1795:Olfr743	UTSW	14	50533702	missense	possibly damaging	0.78
R2011:Olfr743	UTSW	14	50533684	missense	probably damaging	1.00
R2120:Olfr743	UTSW	14	50533946	missense	probably damaging	1.00
R2697:Olfr743	UTSW	14	50533781	missense	probably damaging	1.00
R2857:Olfr743	UTSW	14	50533440	missense	probably benign	0.19
R2858:Olfr743	UTSW	14	50533440	missense	probably benign	0.19
R3906:Olfr743	UTSW	14	50533754	missense	probably benign	0.03
R4327:Olfr743	UTSW	14	50533514	missense	probably benign	0.05
R4355:Olfr743	UTSW	14	50533759	missense	possibly damaging	0.94
R4663:Olfr743	UTSW	14	50533604	missense	probably damaging	1.00
R5214:Olfr743	UTSW	14	50534347	makesense	probably null
R6148:Olfr743	UTSW	14	50534321	missense	probably benign	0.00
R6167:Olfr743	UTSW	14	50534155	missense	probably damaging	1.00
R6301:Olfr743	UTSW	14	50534254	missense	probably benign	0.02
R6616:Olfr743	UTSW	14	50533907	missense	probably benign	0.43
R6910:Olfr743	UTSW	14	50533873	missense	probably benign	0.31
R7076:Olfr743	UTSW	14	50533821	nonsense	probably null
R7483:Olfr743	UTSW	14	50534015	missense	probably benign	0.06
R7574:Olfr743	UTSW	14	50534313	missense	probably benign	0.01
R7731:Olfr743	UTSW	14	50533684	missense	probably damaging	0.99
R8691:Olfr743	UTSW	14	50533453	missense	probably benign	0.01
R9072:Olfr743	UTSW	14	50533754	missense	probably benign	0.03
R9073:Olfr743	UTSW	14	50533754	missense	probably benign	0.03
R9321:Olfr743	UTSW	14	50534014	missense	probably benign	0.01
R9478:Olfr743	UTSW	14	50533594	missense	probably benign	0.01
R9557:Olfr743	UTSW	14	50534095	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GGAGGTTTTCTGGACAATTATAATGT -3'
(R):5'- CCTCCATTTAAATTAGTTTCTGGGA -3'

Sequencing Primer
(F):5'- GTCTATTCTCCTGGTTATTCCTTTCC -3'
(R):5'- GAGAGCATGCATAATTTGTCTTCCC -3'

Posted On

2017-03-31