Incidental Mutation 'R5964:Matn2'
ID471978
Institutional Source Beutler Lab
Gene Symbol Matn2
Ensembl Gene ENSMUSG00000022324
Gene Namematrilin 2
SynonymsCrtm2
MMRRC Submission 044149-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5964 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location34306677-34436273 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34410165 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 501 (N501I)
Ref Sequence ENSEMBL: ENSMUSP00000154572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022947] [ENSMUST00000163455] [ENSMUST00000227759] [ENSMUST00000228570]
Predicted Effect probably damaging
Transcript: ENSMUST00000022947
AA Change: N501I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022947
Gene: ENSMUSG00000022324
AA Change: N501I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
VWA 55 237 1.99e-49 SMART
EGF 241 278 6.86e-4 SMART
EGF 282 319 5.49e-3 SMART
EGF 323 360 7.88e-4 SMART
EGF 364 401 6.76e-3 SMART
EGF 405 442 4.39e-2 SMART
EGF 446 483 9.41e-2 SMART
EGF 487 524 1.24e-1 SMART
EGF 528 565 2.23e-3 SMART
EGF 569 606 8.44e-4 SMART
EGF 610 647 9.55e-3 SMART
VWA 653 831 1.14e-49 SMART
Matrilin_ccoil 889 935 4.78e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163455
AA Change: N501I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128202
Gene: ENSMUSG00000022324
AA Change: N501I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
VWA 55 237 1.99e-49 SMART
EGF 241 278 6.86e-4 SMART
EGF 282 319 5.49e-3 SMART
EGF 323 360 7.88e-4 SMART
EGF 364 401 6.76e-3 SMART
EGF 405 442 4.39e-2 SMART
EGF 446 483 9.41e-2 SMART
EGF 487 524 1.24e-1 SMART
EGF 528 565 2.23e-3 SMART
EGF 569 606 8.44e-4 SMART
EGF 610 647 9.55e-3 SMART
VWA 653 831 1.14e-49 SMART
Matrilin_ccoil 908 955 7.77e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000227759
AA Change: N501I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000228570
AA Change: N501I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.7299 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.2%
Validation Efficiency 96% (87/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the von Willebrand factor A domain containing protein family. This family of proteins is thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. This protein contains five von Willebrand factor A domains. The specific function of this gene has not yet been determined. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are healthy and fertile with no obvious abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam15 G A 3: 89,343,567 Q581* probably null Het
Agl A G 3: 116,793,774 V44A probably damaging Het
Alpk3 T A 7: 81,092,260 D608E possibly damaging Het
Aspm C A 1: 139,455,227 probably benign Het
Bbs2 T C 8: 94,068,367 N692S probably benign Het
Bend4 A G 5: 67,417,818 I240T probably benign Het
Casp8 G T 1: 58,833,736 R277L possibly damaging Het
Ccdc61 A T 7: 18,900,940 I123N probably damaging Het
Ccr9 T G 9: 123,779,434 I60M probably benign Het
Cd163 T A 6: 124,326,572 W1066R probably benign Het
Cd226 A T 18: 89,207,183 H68L probably benign Het
Cdkn3 T A 14: 46,767,217 C79S probably null Het
Cnnm1 A T 19: 43,469,723 E658V probably benign Het
Cog7 T C 7: 121,956,029 R304G probably damaging Het
Cpt1a T A 19: 3,365,760 V286E possibly damaging Het
Creg2 C A 1: 39,624,954 R212L probably benign Het
Cyp26a1 T G 19: 37,699,962 S311A probably damaging Het
Cyp2b10 T C 7: 25,926,223 Y484H probably benign Het
Cyp3a44 T A 5: 145,788,467 Y308F possibly damaging Het
Dlg5 A G 14: 24,164,089 V744A probably benign Het
Dlgap2 T A 8: 14,727,128 Y124* probably null Het
Dnah3 T C 7: 119,922,880 D4030G probably benign Het
Dnah5 A G 15: 28,458,584 T4456A possibly damaging Het
Dtx2 T A 5: 136,023,699 V347D probably benign Het
Gigyf2 C T 1: 87,407,167 T294M probably damaging Het
Gli3 C G 13: 15,726,162 S1378* probably null Het
Gm884 A G 11: 103,542,120 S1232P possibly damaging Het
Gnao1 G A 8: 93,966,999 D337N probably benign Het
Gp2 T A 7: 119,449,129 Q422L probably benign Het
Ifit1 T A 19: 34,648,469 M335K possibly damaging Het
Ism1 T C 2: 139,678,757 S30P probably benign Het
Itgax A G 7: 128,140,447 D677G probably damaging Het
Kansl1l G A 1: 66,725,922 A442V probably damaging Het
Kif13a T C 13: 46,771,524 I311M probably damaging Het
Lsm14b T A 2: 180,031,425 S84R probably benign Het
Lzts3 A G 2: 130,636,288 Y297H probably damaging Het
Map4k3 A G 17: 80,644,762 I205T probably damaging Het
Mctp2 T C 7: 72,103,177 E776G probably damaging Het
Mex3d A T 10: 80,382,587 N265K probably damaging Het
Myo5a A G 9: 75,203,833 T1534A probably benign Het
Ncoa7 T C 10: 30,704,636 M35V probably damaging Het
Nek4 G A 14: 30,957,079 probably null Het
Ngrn T C 7: 80,261,933 probably null Het
Nlrp1a T A 11: 71,123,020 Q468L probably benign Het
Olfr1450 A C 19: 12,954,531 Q314P probably benign Het
Olfr743 T A 14: 50,534,198 M262K probably damaging Het
Phtf2 T C 5: 20,775,934 D433G probably damaging Het
Prdm13 G A 4: 21,683,852 Q140* probably null Het
Prtg G A 9: 72,892,254 G778E probably benign Het
Pum3 T C 19: 27,420,051 E308G probably damaging Het
Pwp1 T G 10: 85,882,886 F306V probably damaging Het
Rab24 A T 13: 55,321,576 Y27N probably damaging Het
Rnf215 T C 11: 4,135,898 F126L probably benign Het
Samd13 A T 3: 146,680,696 probably benign Het
Serac1 T A 17: 6,065,049 H213L probably benign Het
Slc45a3 A G 1: 131,978,073 E278G probably damaging Het
Slit3 C T 11: 35,700,236 R1292C probably damaging Het
Slx4 A T 16: 4,000,951 probably null Het
Smarca4 C A 9: 21,647,430 T631K probably benign Het
Snx16 C T 3: 10,434,481 R163Q possibly damaging Het
Stk40 T C 4: 126,128,895 V140A probably damaging Het
Tcf12 A T 9: 71,868,240 D409E probably damaging Het
Tgfbr2 G T 9: 116,110,255 T168K possibly damaging Het
Ticam1 G T 17: 56,271,703 H131N probably damaging Het
Ttn C A 2: 76,713,511 E31298* probably null Het
Ttn C A 2: 76,829,888 R7458I possibly damaging Het
Usp7 A G 16: 8,712,102 V133A possibly damaging Het
Wbp1l C T 19: 46,654,180 R191* probably null Het
Wdfy4 T C 14: 33,106,011 E1118G probably damaging Het
Zfp81 G C 17: 33,336,845 P3A probably damaging Het
Znhit6 A G 3: 145,576,933 K21R possibly damaging Het
Other mutations in Matn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Matn2 APN 15 34428470 missense probably damaging 1.00
IGL00392:Matn2 APN 15 34402856 missense probably benign 0.00
IGL01475:Matn2 APN 15 34316525 missense possibly damaging 0.94
IGL02223:Matn2 APN 15 34423718 missense probably benign 0.00
IGL02252:Matn2 APN 15 34316590 missense probably damaging 0.98
IGL02288:Matn2 APN 15 34422386 missense probably damaging 1.00
IGL02738:Matn2 APN 15 34388739 missense probably benign 0.07
IGL02927:Matn2 APN 15 34355655 missense probably damaging 1.00
IGL03331:Matn2 APN 15 34345357 missense probably damaging 1.00
Engorged UTSW 15 34426234 missense probably damaging 1.00
PIT4260001:Matn2 UTSW 15 34428731 missense possibly damaging 0.78
R0124:Matn2 UTSW 15 34426151 splice site probably benign
R0422:Matn2 UTSW 15 34435771 unclassified probably null
R0449:Matn2 UTSW 15 34428541 missense probably damaging 1.00
R0606:Matn2 UTSW 15 34345150 missense probably damaging 1.00
R0655:Matn2 UTSW 15 34345200 missense probably benign 0.03
R0885:Matn2 UTSW 15 34316605 missense possibly damaging 0.67
R1384:Matn2 UTSW 15 34409810 missense probably benign 0.00
R1603:Matn2 UTSW 15 34388768 missense probably damaging 1.00
R1667:Matn2 UTSW 15 34378732 missense probably damaging 0.99
R1720:Matn2 UTSW 15 34345274 nonsense probably null
R1772:Matn2 UTSW 15 34428785 missense probably damaging 0.99
R2037:Matn2 UTSW 15 34433117 missense probably benign 0.00
R2107:Matn2 UTSW 15 34423759 missense probably damaging 1.00
R2240:Matn2 UTSW 15 34433063 missense probably damaging 1.00
R3933:Matn2 UTSW 15 34345420 unclassified probably null
R3963:Matn2 UTSW 15 34388791 nonsense probably null
R4648:Matn2 UTSW 15 34428533 missense probably damaging 1.00
R4695:Matn2 UTSW 15 34402925 missense probably damaging 1.00
R4817:Matn2 UTSW 15 34423799 missense probably damaging 1.00
R4935:Matn2 UTSW 15 34428685 missense probably damaging 1.00
R5105:Matn2 UTSW 15 34355668 missense possibly damaging 0.95
R5177:Matn2 UTSW 15 34433514 missense possibly damaging 0.58
R5717:Matn2 UTSW 15 34399091 nonsense probably null
R5760:Matn2 UTSW 15 34355607 missense possibly damaging 0.46
R5776:Matn2 UTSW 15 34431619 missense probably damaging 1.00
R5842:Matn2 UTSW 15 34399056 missense probably damaging 0.99
R5917:Matn2 UTSW 15 34409766 nonsense probably null
R6265:Matn2 UTSW 15 34399155 missense probably damaging 1.00
R6272:Matn2 UTSW 15 34355607 missense possibly damaging 0.46
R6332:Matn2 UTSW 15 34423755 missense probably benign 0.00
R6457:Matn2 UTSW 15 34426234 missense probably damaging 1.00
R7351:Matn2 UTSW 15 34345336 missense probably damaging 0.97
R7660:Matn2 UTSW 15 34402946 missense probably benign 0.00
R7660:Matn2 UTSW 15 34423728 nonsense probably null
R7775:Matn2 UTSW 15 34399077 missense possibly damaging 0.94
R7778:Matn2 UTSW 15 34399077 missense possibly damaging 0.94
R8007:Matn2 UTSW 15 34426169 missense not run
R8059:Matn2 UTSW 15 34345335 missense not run
Predicted Primers PCR Primer
(F):5'- ACTAAGGGGAAATCTTCTGGGG -3'
(R):5'- GGAACACCAGTGGCTTCAAG -3'

Sequencing Primer
(F):5'- GGCCGCATGCTTTCAATG -3'
(R):5'- CACCAGTGGCTTCAAGATATAGGC -3'
Posted On2017-03-31