Mutagenetix > Incidental Mutation

Incidental Mutation 'R5964:Matn2'

471978

Institutional Source

Beutler Lab

Gene Symbol

Matn2

Ensembl Gene

ENSMUSG00000022324

Gene Name

matrilin 2

Synonyms

Crtm2

MMRRC Submission

044149-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5964 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

34306677-34436273 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 34410165 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 501 (N501I)

Ref Sequence

ENSEMBL: ENSMUSP00000154572 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022947] [ENSMUST00000163455] [ENSMUST00000227759] [ENSMUST00000228570]

AlphaFold

O08746

Predicted Effect

probably damaging
Transcript: ENSMUST00000022947
AA Change: N501I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000022947
Gene: ENSMUSG00000022324
AA Change: N501I

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
VWA	55	237	1.99e-49	SMART
EGF	241	278	6.86e-4	SMART
EGF	282	319	5.49e-3	SMART
EGF	323	360	7.88e-4	SMART
EGF	364	401	6.76e-3	SMART
EGF	405	442	4.39e-2	SMART
EGF	446	483	9.41e-2	SMART
EGF	487	524	1.24e-1	SMART
EGF	528	565	2.23e-3	SMART
EGF	569	606	8.44e-4	SMART
EGF	610	647	9.55e-3	SMART
VWA	653	831	1.14e-49	SMART
Matrilin_ccoil	889	935	4.78e-14	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000163455
AA Change: N501I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000128202
Gene: ENSMUSG00000022324
AA Change: N501I

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
VWA	55	237	1.99e-49	SMART
EGF	241	278	6.86e-4	SMART
EGF	282	319	5.49e-3	SMART
EGF	323	360	7.88e-4	SMART
EGF	364	401	6.76e-3	SMART
EGF	405	442	4.39e-2	SMART
EGF	446	483	9.41e-2	SMART
EGF	487	524	1.24e-1	SMART
EGF	528	565	2.23e-3	SMART
EGF	569	606	8.44e-4	SMART
EGF	610	647	9.55e-3	SMART
VWA	653	831	1.14e-49	SMART
Matrilin_ccoil	908	955	7.77e-14	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000227759
AA Change: N501I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000228570
AA Change: N501I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Meta Mutation Damage Score

0.7299

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.2%

Validation Efficiency

96% (87/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the von Willebrand factor A domain containing protein family. This family of proteins is thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. This protein contains five von Willebrand factor A domains. The specific function of this gene has not yet been determined. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are healthy and fertile with no obvious abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam15	G	A	3: 89,343,567	Q581*	probably null	Het
Agl	A	G	3: 116,793,774	V44A	probably damaging	Het
Alpk3	T	A	7: 81,092,260	D608E	possibly damaging	Het
Aspm	C	A	1: 139,455,227		probably benign	Het
Bbs2	T	C	8: 94,068,367	N692S	probably benign	Het
Bend4	A	G	5: 67,417,818	I240T	probably benign	Het
Casp8	G	T	1: 58,833,736	R277L	possibly damaging	Het
Ccdc61	A	T	7: 18,900,940	I123N	probably damaging	Het
Ccr9	T	G	9: 123,779,434	I60M	probably benign	Het
Cd163	T	A	6: 124,326,572	W1066R	probably benign	Het
Cd226	A	T	18: 89,207,183	H68L	probably benign	Het
Cdkn3	T	A	14: 46,767,217	C79S	probably null	Het
Cnnm1	A	T	19: 43,469,723	E658V	probably benign	Het
Cog7	T	C	7: 121,956,029	R304G	probably damaging	Het
Cpt1a	T	A	19: 3,365,760	V286E	possibly damaging	Het
Creg2	C	A	1: 39,624,954	R212L	probably benign	Het
Cyp26a1	T	G	19: 37,699,962	S311A	probably damaging	Het
Cyp2b10	T	C	7: 25,926,223	Y484H	probably benign	Het
Cyp3a44	T	A	5: 145,788,467	Y308F	possibly damaging	Het
Dlg5	A	G	14: 24,164,089	V744A	probably benign	Het
Dlgap2	T	A	8: 14,727,128	Y124*	probably null	Het
Dnah3	T	C	7: 119,922,880	D4030G	probably benign	Het
Dnah5	A	G	15: 28,458,584	T4456A	possibly damaging	Het
Dtx2	T	A	5: 136,023,699	V347D	probably benign	Het
Gigyf2	C	T	1: 87,407,167	T294M	probably damaging	Het
Gli3	C	G	13: 15,726,162	S1378*	probably null	Het
Gm884	A	G	11: 103,542,120	S1232P	possibly damaging	Het
Gnao1	G	A	8: 93,966,999	D337N	probably benign	Het
Gp2	T	A	7: 119,449,129	Q422L	probably benign	Het
Ifit1	T	A	19: 34,648,469	M335K	possibly damaging	Het
Ism1	T	C	2: 139,678,757	S30P	probably benign	Het
Itgax	A	G	7: 128,140,447	D677G	probably damaging	Het
Kansl1l	G	A	1: 66,725,922	A442V	probably damaging	Het
Kif13a	T	C	13: 46,771,524	I311M	probably damaging	Het
Lsm14b	T	A	2: 180,031,425	S84R	probably benign	Het
Lzts3	A	G	2: 130,636,288	Y297H	probably damaging	Het
Map4k3	A	G	17: 80,644,762	I205T	probably damaging	Het
Mctp2	T	C	7: 72,103,177	E776G	probably damaging	Het
Mex3d	A	T	10: 80,382,587	N265K	probably damaging	Het
Myo5a	A	G	9: 75,203,833	T1534A	probably benign	Het
Ncoa7	T	C	10: 30,704,636	M35V	probably damaging	Het
Nek4	G	A	14: 30,957,079		probably null	Het
Ngrn	T	C	7: 80,261,933		probably null	Het
Nlrp1a	T	A	11: 71,123,020	Q468L	probably benign	Het
Olfr1450	A	C	19: 12,954,531	Q314P	probably benign	Het
Olfr743	T	A	14: 50,534,198	M262K	probably damaging	Het
Phtf2	T	C	5: 20,775,934	D433G	probably damaging	Het
Prdm13	G	A	4: 21,683,852	Q140*	probably null	Het
Prtg	G	A	9: 72,892,254	G778E	probably benign	Het
Pum3	T	C	19: 27,420,051	E308G	probably damaging	Het
Pwp1	T	G	10: 85,882,886	F306V	probably damaging	Het
Rab24	A	T	13: 55,321,576	Y27N	probably damaging	Het
Rnf215	T	C	11: 4,135,898	F126L	probably benign	Het
Samd13	A	T	3: 146,680,696		probably benign	Het
Serac1	T	A	17: 6,065,049	H213L	probably benign	Het
Slc45a3	A	G	1: 131,978,073	E278G	probably damaging	Het
Slit3	C	T	11: 35,700,236	R1292C	probably damaging	Het
Slx4	A	T	16: 4,000,951		probably null	Het
Smarca4	C	A	9: 21,647,430	T631K	probably benign	Het
Snx16	C	T	3: 10,434,481	R163Q	possibly damaging	Het
Stk40	T	C	4: 126,128,895	V140A	probably damaging	Het
Tcf12	A	T	9: 71,868,240	D409E	probably damaging	Het
Tgfbr2	G	T	9: 116,110,255	T168K	possibly damaging	Het
Ticam1	G	T	17: 56,271,703	H131N	probably damaging	Het
Ttn	C	A	2: 76,829,888	R7458I	possibly damaging	Het
Ttn	C	A	2: 76,713,511	E31298*	probably null	Het
Usp7	A	G	16: 8,712,102	V133A	possibly damaging	Het
Wbp1l	C	T	19: 46,654,180	R191*	probably null	Het
Wdfy4	T	C	14: 33,106,011	E1118G	probably damaging	Het
Zfp81	G	C	17: 33,336,845	P3A	probably damaging	Het
Znhit6	A	G	3: 145,576,933	K21R	possibly damaging	Het

Other mutations in Matn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00264:Matn2	APN	15	34428470	missense	probably damaging	1.00
IGL00392:Matn2	APN	15	34402856	missense	probably benign	0.00
IGL01475:Matn2	APN	15	34316525	missense	possibly damaging	0.94
IGL02223:Matn2	APN	15	34423718	missense	probably benign	0.00
IGL02252:Matn2	APN	15	34316590	missense	probably damaging	0.98
IGL02288:Matn2	APN	15	34422386	missense	probably damaging	1.00
IGL02738:Matn2	APN	15	34388739	missense	probably benign	0.07
IGL02927:Matn2	APN	15	34355655	missense	probably damaging	1.00
IGL03331:Matn2	APN	15	34345357	missense	probably damaging	1.00
Engorged	UTSW	15	34426234	missense	probably damaging	1.00
PIT4260001:Matn2	UTSW	15	34428731	missense	possibly damaging	0.78
R0124:Matn2	UTSW	15	34426151	splice site	probably benign
R0422:Matn2	UTSW	15	34435771	splice site	probably null
R0449:Matn2	UTSW	15	34428541	missense	probably damaging	1.00
R0606:Matn2	UTSW	15	34345150	missense	probably damaging	1.00
R0655:Matn2	UTSW	15	34345200	missense	probably benign	0.03
R0885:Matn2	UTSW	15	34316605	missense	possibly damaging	0.67
R1384:Matn2	UTSW	15	34409810	missense	probably benign	0.00
R1603:Matn2	UTSW	15	34388768	missense	probably damaging	1.00
R1667:Matn2	UTSW	15	34378732	missense	probably damaging	0.99
R1720:Matn2	UTSW	15	34345274	nonsense	probably null
R1772:Matn2	UTSW	15	34428785	missense	probably damaging	0.99
R2037:Matn2	UTSW	15	34433117	missense	probably benign	0.00
R2107:Matn2	UTSW	15	34423759	missense	probably damaging	1.00
R2240:Matn2	UTSW	15	34433063	missense	probably damaging	1.00
R3933:Matn2	UTSW	15	34345420	splice site	probably null
R3963:Matn2	UTSW	15	34388791	nonsense	probably null
R4648:Matn2	UTSW	15	34428533	missense	probably damaging	1.00
R4695:Matn2	UTSW	15	34402925	missense	probably damaging	1.00
R4817:Matn2	UTSW	15	34423799	missense	probably damaging	1.00
R4935:Matn2	UTSW	15	34428685	missense	probably damaging	1.00
R5105:Matn2	UTSW	15	34355668	missense	possibly damaging	0.95
R5177:Matn2	UTSW	15	34433514	missense	possibly damaging	0.58
R5717:Matn2	UTSW	15	34399091	nonsense	probably null
R5760:Matn2	UTSW	15	34355607	missense	possibly damaging	0.46
R5776:Matn2	UTSW	15	34431619	missense	probably damaging	1.00
R5842:Matn2	UTSW	15	34399056	missense	probably damaging	0.99
R5917:Matn2	UTSW	15	34409766	nonsense	probably null
R6265:Matn2	UTSW	15	34399155	missense	probably damaging	1.00
R6272:Matn2	UTSW	15	34355607	missense	possibly damaging	0.46
R6332:Matn2	UTSW	15	34423755	missense	probably benign	0.00
R6457:Matn2	UTSW	15	34426234	missense	probably damaging	1.00
R7351:Matn2	UTSW	15	34345336	missense	probably damaging	0.97
R7660:Matn2	UTSW	15	34402946	missense	probably benign	0.00
R7660:Matn2	UTSW	15	34423728	nonsense	probably null
R7775:Matn2	UTSW	15	34399077	missense	possibly damaging	0.94
R7778:Matn2	UTSW	15	34399077	missense	possibly damaging	0.94
R8007:Matn2	UTSW	15	34426169	missense	probably benign	0.01
R8059:Matn2	UTSW	15	34345335	missense	probably damaging	1.00
R8174:Matn2	UTSW	15	34422409	missense	probably benign	0.30
R8331:Matn2	UTSW	15	34428681	missense	probably damaging	1.00
R8354:Matn2	UTSW	15	34378697	missense	probably damaging	0.98
R8377:Matn2	UTSW	15	34345365	missense	probably damaging	1.00
R8393:Matn2	UTSW	15	34355602	missense	possibly damaging	0.92
R8532:Matn2	UTSW	15	34316553	missense	probably benign	0.42
R8555:Matn2	UTSW	15	34423805	missense	probably benign	0.03
R8756:Matn2	UTSW	15	34423730	missense	possibly damaging	0.94
R8973:Matn2	UTSW	15	34433050	missense	probably benign	0.01
R9198:Matn2	UTSW	15	34423778	missense	probably damaging	0.99
R9220:Matn2	UTSW	15	34410179	missense	possibly damaging	0.58
R9478:Matn2	UTSW	15	34345096	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTAAGGGGAAATCTTCTGGGG -3'
(R):5'- GGAACACCAGTGGCTTCAAG -3'

Sequencing Primer
(F):5'- GGCCGCATGCTTTCAATG -3'
(R):5'- CACCAGTGGCTTCAAGATATAGGC -3'

Posted On

2017-03-31