Mutagenetix > Incidental Mutations

Incidental Mutation 'R5964:Usp7'

471979

Institutional Source

Beutler Lab

Gene Symbol

Usp7

Ensembl Gene

ENSMUSG00000022710

Gene Name

ubiquitin specific peptidase 7

Synonyms

2210010O09Rik

MMRRC Submission

044149-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5964 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

8689595-8792308 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 8712102 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 133 (V133A)

Ref Sequence

ENSEMBL: ENSMUSP00000124382 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000160326] [ENSMUST00000160405] [ENSMUST00000161046]

Predicted Effect

probably benign
Transcript: ENSMUST00000160326

SMART Domains

Protein: ENSMUSP00000124576
Gene: ENSMUSG00000022710

Domain	Start	End	E-Value	Type
PDB:2F1Z\|B	43	83	2e-18	PDB

Predicted Effect

possibly damaging
Transcript: ENSMUST00000160405
AA Change: V133A

PolyPhen 2 Score 0.516 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000124382
Gene: ENSMUSG00000022710
AA Change: V133A

Domain	Start	End	E-Value	Type
low complexity region	3	12	N/A	INTRINSIC
MATH	111	217	4.27e-22	SMART
Pfam:UCH	254	559	5.7e-53	PFAM
Pfam:UCH_1	255	528	3.7e-22	PFAM
Pfam:USP7_ICP0_bdg	661	906	7.1e-79	PFAM
Pfam:USP7_C2	916	1127	4.9e-63	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000161046
AA Change: V93A

PolyPhen 2 Score 0.295 (Sensitivity: 0.91; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000124093
Gene: ENSMUSG00000022710
AA Change: V93A

Domain	Start	End	E-Value	Type
MATH	71	177	4.27e-22	SMART
Pfam:UCH	214	519	9.6e-60	PFAM
Pfam:UCH_1	215	488	5.1e-29	PFAM
Pfam:USP7_ICP0_bdg	620	866	5e-83	PFAM
Pfam:USP7_C2	875	1089	2.7e-69	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162445

Meta Mutation Damage Score

0.3029

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.2%

Validation Efficiency

96% (87/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the peptidase C19 family, which includes ubiquitinyl hydrolases. This protein deubiquitinates target proteins such as p53 (a tumor suppressor protein) and WASH (essential for endosomal protein recycling), and regulates their activities by counteracting the opposing ubiquitin ligase activity of proteins such as HDM2 and TRIM27, involved in the respective process. Mutations in this gene have been implicated in a neurodevelopmental disorder. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a null allele show embryonic growth arrest and die between E6.5 and E7.5. Mice homozygous for a conditional allele activated in neural cells exhibit complete neonatal lethality, absent gastric milk, uncoordinated movement and abnormalforebrain morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam15	G	A	3: 89,343,567	Q581*	probably null	Het
Agl	A	G	3: 116,793,774	V44A	probably damaging	Het
Alpk3	T	A	7: 81,092,260	D608E	possibly damaging	Het
Aspm	C	A	1: 139,455,227		probably benign	Het
Bbs2	T	C	8: 94,068,367	N692S	probably benign	Het
Bend4	A	G	5: 67,417,818	I240T	probably benign	Het
Casp8	G	T	1: 58,833,736	R277L	possibly damaging	Het
Ccdc61	A	T	7: 18,900,940	I123N	probably damaging	Het
Ccr9	T	G	9: 123,779,434	I60M	probably benign	Het
Cd163	T	A	6: 124,326,572	W1066R	probably benign	Het
Cd226	A	T	18: 89,207,183	H68L	probably benign	Het
Cdkn3	T	A	14: 46,767,217	C79S	probably null	Het
Cnnm1	A	T	19: 43,469,723	E658V	probably benign	Het
Cog7	T	C	7: 121,956,029	R304G	probably damaging	Het
Cpt1a	T	A	19: 3,365,760	V286E	possibly damaging	Het
Creg2	C	A	1: 39,624,954	R212L	probably benign	Het
Cyp26a1	T	G	19: 37,699,962	S311A	probably damaging	Het
Cyp2b10	T	C	7: 25,926,223	Y484H	probably benign	Het
Cyp3a44	T	A	5: 145,788,467	Y308F	possibly damaging	Het
Dlg5	A	G	14: 24,164,089	V744A	probably benign	Het
Dlgap2	T	A	8: 14,727,128	Y124*	probably null	Het
Dnah3	T	C	7: 119,922,880	D4030G	probably benign	Het
Dnah5	A	G	15: 28,458,584	T4456A	possibly damaging	Het
Dtx2	T	A	5: 136,023,699	V347D	probably benign	Het
Gigyf2	C	T	1: 87,407,167	T294M	probably damaging	Het
Gli3	C	G	13: 15,726,162	S1378*	probably null	Het
Gm884	A	G	11: 103,542,120	S1232P	possibly damaging	Het
Gnao1	G	A	8: 93,966,999	D337N	probably benign	Het
Gp2	T	A	7: 119,449,129	Q422L	probably benign	Het
Ifit1	T	A	19: 34,648,469	M335K	possibly damaging	Het
Ism1	T	C	2: 139,678,757	S30P	probably benign	Het
Itgax	A	G	7: 128,140,447	D677G	probably damaging	Het
Kansl1l	G	A	1: 66,725,922	A442V	probably damaging	Het
Kif13a	T	C	13: 46,771,524	I311M	probably damaging	Het
Lsm14b	T	A	2: 180,031,425	S84R	probably benign	Het
Lzts3	A	G	2: 130,636,288	Y297H	probably damaging	Het
Map4k3	A	G	17: 80,644,762	I205T	probably damaging	Het
Matn2	A	T	15: 34,410,165	N501I	probably damaging	Het
Mctp2	T	C	7: 72,103,177	E776G	probably damaging	Het
Mex3d	A	T	10: 80,382,587	N265K	probably damaging	Het
Myo5a	A	G	9: 75,203,833	T1534A	probably benign	Het
Ncoa7	T	C	10: 30,704,636	M35V	probably damaging	Het
Nek4	G	A	14: 30,957,079		probably null	Het
Ngrn	T	C	7: 80,261,933		probably null	Het
Nlrp1a	T	A	11: 71,123,020	Q468L	probably benign	Het
Olfr1450	A	C	19: 12,954,531	Q314P	probably benign	Het
Olfr743	T	A	14: 50,534,198	M262K	probably damaging	Het
Phtf2	T	C	5: 20,775,934	D433G	probably damaging	Het
Prdm13	G	A	4: 21,683,852	Q140*	probably null	Het
Prtg	G	A	9: 72,892,254	G778E	probably benign	Het
Pum3	T	C	19: 27,420,051	E308G	probably damaging	Het
Pwp1	T	G	10: 85,882,886	F306V	probably damaging	Het
Rab24	A	T	13: 55,321,576	Y27N	probably damaging	Het
Rnf215	T	C	11: 4,135,898	F126L	probably benign	Het
Samd13	A	T	3: 146,680,696		probably benign	Het
Serac1	T	A	17: 6,065,049	H213L	probably benign	Het
Slc45a3	A	G	1: 131,978,073	E278G	probably damaging	Het
Slit3	C	T	11: 35,700,236	R1292C	probably damaging	Het
Slx4	A	T	16: 4,000,951		probably null	Het
Smarca4	C	A	9: 21,647,430	T631K	probably benign	Het
Snx16	C	T	3: 10,434,481	R163Q	possibly damaging	Het
Stk40	T	C	4: 126,128,895	V140A	probably damaging	Het
Tcf12	A	T	9: 71,868,240	D409E	probably damaging	Het
Tgfbr2	G	T	9: 116,110,255	T168K	possibly damaging	Het
Ticam1	G	T	17: 56,271,703	H131N	probably damaging	Het
Ttn	C	A	2: 76,713,511	E31298*	probably null	Het
Ttn	C	A	2: 76,829,888	R7458I	possibly damaging	Het
Wbp1l	C	T	19: 46,654,180	R191*	probably null	Het
Wdfy4	T	C	14: 33,106,011	E1118G	probably damaging	Het
Zfp81	G	C	17: 33,336,845	P3A	probably damaging	Het
Znhit6	A	G	3: 145,576,933	K21R	possibly damaging	Het

Other mutations in Usp7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00477:Usp7	APN	16	8697975	missense	probably damaging	0.96
IGL00496:Usp7	APN	16	8695113	missense	probably damaging	0.99
IGL02113:Usp7	APN	16	8716513	critical splice donor site	probably null
IGL02873:Usp7	APN	16	8695194	unclassified	probably benign
IGL03036:Usp7	APN	16	8738214	missense	probably benign	0.00
PIT4402001:Usp7	UTSW	16	8698495	missense	probably benign
R0066:Usp7	UTSW	16	8691418	missense	probably benign
R0400:Usp7	UTSW	16	8716632	splice site	probably benign
R0483:Usp7	UTSW	16	8699262	missense	probably damaging	1.00
R0625:Usp7	UTSW	16	8704982	missense	probably benign	0.00
R0626:Usp7	UTSW	16	8693914	missense	possibly damaging	0.54
R0837:Usp7	UTSW	16	8703502	missense	probably damaging	1.00
R0967:Usp7	UTSW	16	8696654	unclassified	probably benign
R1929:Usp7	UTSW	16	8698469	missense	probably benign	0.00
R2270:Usp7	UTSW	16	8698469	missense	probably benign	0.00
R2271:Usp7	UTSW	16	8698469	missense	probably benign	0.00
R2272:Usp7	UTSW	16	8698469	missense	probably benign	0.00
R3949:Usp7	UTSW	16	8716564	missense	probably damaging	1.00
R4411:Usp7	UTSW	16	8708914	missense	probably damaging	1.00
R4413:Usp7	UTSW	16	8708914	missense	probably damaging	1.00
R4500:Usp7	UTSW	16	8695895	missense	possibly damaging	0.89
R4651:Usp7	UTSW	16	8698414	intron	probably benign
R4852:Usp7	UTSW	16	8756844	nonsense	probably null
R5483:Usp7	UTSW	16	8698540	missense	probably benign
R5610:Usp7	UTSW	16	8716510	splice site	probably null
R5734:Usp7	UTSW	16	8701981	missense	possibly damaging	0.91
R6753:Usp7	UTSW	16	8696911	missense	probably benign	0.25
R7171:Usp7	UTSW	16	8716526	missense	probably benign	0.01
R7263:Usp7	UTSW	16	8696724	missense	possibly damaging	0.89
R7420:Usp7	UTSW	16	8710121	missense	probably benign
R7654:Usp7	UTSW	16	8702043	missense	probably benign	0.33
R7789:Usp7	UTSW	16	8698811	missense	probably benign
R7808:Usp7	UTSW	16	8705163	missense	probably damaging	1.00
R8080:Usp7	UTSW	16	8697907	missense	probably benign	0.42
R8353:Usp7	UTSW	16	8695871	missense	probably benign	0.01
R8502:Usp7	UTSW	16	8695029	critical splice donor site	probably null
R8548:Usp7	UTSW	16	8712075	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- GGACTGTTCCAGAGTGACAAAG -3'
(R):5'- CAGTTGGACTGGATGGAGATC -3'

Sequencing Primer
(F):5'- AAACTAAAACTGGGCAAGACTG -3'
(R):5'- GAGATCTTGTAGAGCAGTTACTCCAG -3'

Posted On

2017-03-31